%PDF-1.6 % 962 0 obj <> endobj 981 0 obj <>/Filter/FlateDecode/ID[<19B0D7C542A4134290292F11027B83EF>]/Index[962 29]/Info 961 0 R/Length 98/Prev 1069768/Root 963 0 R/Size 991/Type/XRef/W[1 3 1]>>stream hbbd```b``u`rX$D$I`5Qfɔ fsI d)"@QH79$TEOx: endstream endobj startxref 0 %%EOF 990 0 obj <>stream hb```jVaf`0pT40p8r0hp0p6,ޤ5F l˄52ؼ\^pՊ=?!G?& 'yx 0Iԑyj|c{Hsܫ$}hE%筪m_.j<q$rK @PDv:B@b L dhI4 A%AA܀ڙR?rv@I36 e&йϢE08=`xZ $J,8A pf"n%k endstream endobj 963 0 obj <>/Metadata 106 0 R/Pages 957 0 R/StructTreeRoot 175 0 R/Type/Catalog>> endobj 964 0 obj <>/MediaBox[0 0 595.32 841.92]/Parent 958 0 R/Resources<>/Font<>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI]/XObject<>>>/Rotate 0/StructParents 0/Tabs/S/Type/Page>> endobj 965 0 obj <>stream hޜmk0ǿޏ"`JqmA 5q$t][}#DH4hF0ZMdbd焳\[:Їm9:ڇ`KK`p( {(ڥ?5Qiiwߜ_Нd7qeW-@: b"b"ǾrX?n-hj|ϻ$c{@W#N+gRipX_w+k.lP01<h>stream xWMo8Q*`3TQH4Mf/@|ډȪ| Pf8||,]>)ĻwÓ'Nxu84^c^ÛM{q::?=%B E0 3iAZ~a | b@^7^VY4EwU:<]:0q2aiHSM~buՂe;edZl|XL)e:X*"ڬ6=Tf0LG|ՙ(-a(ڷh5K%t'(לH!.:oj7+Tg  Khfkg4.A1a |gLPLƤR6Za==DaKHA~.6Qڪcbp(pIgJKb,%wPD D:&H%try 6lró5V<ly6Ouɷ=Ytɸ5jzufu;B*|5YJu PHVg'I4]6q[Q:_WFVn4Q jP{B<+ ʢą D{T+W;^Ik*U8Y֫<`% USuLWP\]/-ԸK^(|K&Uhc,Iz#@l] AW``{ ڰli£0xupg $%C;[a >/;MIaJg2#l@y.8*X4/j<81 YبqJۑZNz--)wQS܋X/ai+Mس\8 )1!>ȶmgVm:TJ./G<Ŀ_Xɏ:aԺƫsJە:W% [3<_Uj],Hѫ endstream endobj 967 0 obj <>stream x]xźm)&Iv%l tB,i"% 5! DQ(+zlG, J QQ;A@=7O'>0KćU|,fX {>kf|Fc_QW_(6(,*ޑn 7[kltɼQ7+YNEE#zl/mBVK>StuuWL߉?,;S6D~]-C\SIqS zcW7b`O{9;)wWuWgmt}'2g.c)seʽP1PT,yw$OYPtҽX>KO t+LG4=3{EM.-la{M5gO~'3vLjS-la [ [-la [-la2%-la [-la [-la [-la [-la [-la [kG lTӱoŜP(3VF3bul6k`N>(}3¹:ŃvCj<%J?mk;.ګY׉]T}xc͔ݡ/X_RU^-$stTU'f:{dcL|#P*gV mvҸMުP_Zz -q/SrV$T,`+P@NQh(r[9}Y?V!H,d5kJ{ gow B̒siOJoE`scWj-8pEӥ%Ōu0<%!TzP3 F,U-iwUN${M̀阺,pi=MhѠn΢cءR}NNEE(a9Rfع)FsYLv8]pc yEXk[Z.-f;J&tHQ~.̅lP =v9Zz>y\vvv57״05S,e{ ׄࢊXO;0vvn1hׄbw*,njko6/(}.ivڵƏ%Jy|T7/(ߊי •ouyNpi<&-޾XZ3g>ΪYAYڃ-U(+uD]C&XD6 2Z`okFx! <Yk47s{ xSK׾Ui|( tćc*㾣=MF3ԯ}""_Var='EVT7WVӃ%b{ (ah!:D?Oo~#V>Olq6Wqc^SEζ ~K.쥩d ƒ>sFT="T]%|~Q֘YR]})+DHI 5Dj@DVF7ZrknM xv_-6=8`Ȣ:YA9q>ჽNP#U j7+Fʱei'O-|]VH{(nQ@DOToz3Giku<BPJD[MOjx8:E3KvQsea8Bu Q<#.r1CcبxG`GxYs77'.@e2aͩdVX,8m9ī=Eјk<ʍ7)rT(4yv4$^Z͖!2C)#b\3{]g-@V 3lvZ܃C+R|*'R|,ߤH=RC)>})*{R+;R-[R)Ru)^U)^e)vJ/JKJOK;OJۥx\ǤxTGxXmRlM-R<$ŃRlU-Rx@O{$=RYK;CۥIqEIA른NkFJ+B˥L R\*%Rb).Y @uR|)䵇k.=\^{py嵇k.=\^{py嵇k_$py.?\py.?\py.?\py.?\pym.o;\vpym Ѧ9:R3(hU0#R+&:hy0}8`zhRF[BDȹ0Z@4h%j L+A4hQ]0TKjDUDD3SiJ4h2QhD"rDeD!Mt:Q)ѨTB42hATADD7y0ӈRT|Q.@D~D}>DzQe9D=\l"QwnD]PYDTgg"7Q'Er t4";Qj0u ((9:DH"9∬g!%g (""(Dd$2SƁ2H%B)N4D~R?$:@y?Qj?яD?}L.\R}MԗD{ωI}FwO)J}LQ#=D)C>_#zBޡDo& &MAF*+2NrD" DSsDϒ"A|ROm'z#z=Lh+QEnCDm&j &恂)DGt/&{8; ODJf&)뉮# \C"Z.'6]Jt z)"J5]Ht:*@L 8`*T|;`B h9?hRF%DET|!т`B5h>U6"5!:h6'E-D5YM4ht4jT)Tu=O4;Z&'* ڼqAxؠM,1A蠭t )%^K(5h9Um0h[ *ښ@bp"/QѰ`4J Z+@Cbi " ZG~Ѐu2?#fPdUtW*fQO*ރMʺuʺu!" Z(u&rSNUZDT.(NJL%-AIA P"Q(( XD1DfhHrFDS*Bĉ=vCplPlg'#= k__{yDg߁Ocf9>w| nH.y-soǛ7 ],kЯ=W s/@?3Ϙg;6;2r@ٿ''ov|><<H"ыۢ8mDfZ@rQg9Z7jcS*=;;z8n enof蛀o@]ףP׵]\ \\ \\r cFu\9˱>őw9W3穹5?euʥ)jlɊ7[vqlI&}&uY-D5A-qb {Htg&GRU_T\&l bQ.~N8&xJLl|i4nJ_,޲<%$lJ׳@z?nܘ_Qht !{ӘuuUMxE山7q(=FXkvnVfxDDPR|yQcoT^A7G_UY2/hHUF^iըFaaKsɩKo7G77y+e p.pV+YrL`h`>0 4s3@=0 j T `:0 L&L|〱`4p:P J(  x<`p0 @`^@d; tL3:. 8 H@*$I@"؀x  @4D 0@膷Spa3p8~~__{/ρ>| || >>    ^^^^^v///OO;OOہǁǀGGmV <<lZ {M=;;ہ?[kk++ˁˀ %zb"Xg5Û8?csϱ9?csϱ9?gqpgqpgqpgqpgqpgqpgqpgqpϱ9>{cs}ϱ9>sonlc.f’gLgofM8v[̚𵖭gW{l&[udf{ͯ,Z ,{ c\Tyni8ߗhn3ıHYy ox">@uбZ7~]ǍA̦ldU g12sXiyț:fhFG"5Z8y t#[3rv;`+C4 䜥V՘sعL5fm]xԅGT3]y]zRCj.cc=\ɮbWk.n`7F_nf`͈ES"4{`icYQR p1-[vdVo͡ ǔXGT ̓eq#} }GJQﱣr*P{Of7aފO1BMMHF-'v;sq$NM^|*}X V34No G<[60Vcl;N'%=xȻCQIEfz^d/ک}>+5:{^e!cÆmt6_yoT6o_־_\ ,mf'yG#E>b6u*wokqj.V_Ӌkdh6]8qKId&z DaNaLoN1oIMsooXZKxyΜC缿=wZݳkO^v-ռE4W Tk(h* $9ϓӳ3dzӃj oR;L ͔j6h]PhR9l0ܫWRNNdPsSCM 575PsS7sdhq@`d$")zڷ{SD:(JN2$ipt-s|ZYBck9NWv:Vahg 򢦶9UNƒ2N][-h7V;IM:hq[Xg֕-c`rR,s½IYN"۔!^ Lett\zm\^,1q[]{ JOBhd*A! Aӥ(TVր\;uIFR5,+fR'EwNKw(&>[%#ŝeRW*YCSct!:b&U>cT9hSHqmߧ‘9G7̺)üщsҕNm<eS;{n[:mu8VJO<ؐn D6Xz+zE|;QuǜSjiG46L5$57[,;gⲒ&l9{m+Օ?=KFY\nW\1pf^]7Ýaپ1glA-*6oDDO15:cjj@XT1aw~*:\ΝmĚ@Wߺ6ԭVvxKݕ^t_Y?6 ̜\c3Phvk3' cE8cQp%erSM bk:ђoMah=O37Lo=K4'5IwY$vU[9;p{ u+֪1N-  ?HvIT^E' 7Aa3az~UE;ݰjLaQX:ՍJsI -(4ofy SH oX܅VBk[Dd գg(,9(=V[τ, m3*7e ITG>|hhb6'i[ fiW9(LTPcʘ) JH YY}" I @J~#~ l&[m;M_ q8ٍ:t|}L0[:Yʞz}=ݾ+]Z 7Pd nP\fޣ: fX 0# JfŵgqiyzZkg ]4 Lq*\A0Ze;;t-~ЭxoTzONwGy_~Hh)?4=NB{hp+`c(Rsi.%fHZG\Vs9G(Qd^yUdf[ӓ %@)_p`U4y2MAkRT{Pev攳7m z̯MϷg-ju&m"} ?ў۰*)BW6+%n~šHz=C /|(ipE/J.+.0u<0P#Q#]IIZ[?PuV0аrEꈎ>qyfq M- xqȦXnˑRlheZ ]1 j,5]F7u5zSr&4N6+XvQj: gi3xk"tBDpj"`P)a_9CsYf֒ͪ2,Anjd^mOY1e(kAf~Tخc |}e==Wq z=-O+B;AVύuV[okǿjk>?<8uscv;}cs;;}YH`[fd#4rݑ 9!I598-.*hpX* F>XbM0zQKGx<4]$rD9\=vv>磜$W\RQXRFd&#mAQ&0r T+xy<L8ݪخ%)j[GG`vAc:\Z"['!tBgqg3 dܚ]k[|#|?bJ^cîϬ }scִT2J,j,.GMkۢŵ@6yALC .sr`=,a) K $p|VNjpmwA.q✡|7  Ld>?2*cNB#m}[0 i]6r6VD(^Y<$aG6/\4cmNndg]ģ7;,ЫMFZ*'U᳷C͜g,>ƻへ_np\GcGK<@  &0`+CcCc[7}a/k)kVq|mʲt[A lI+or̴iC6ƍ*dx-j[#*w=ƿ8uct0F~cm VSnCwEŰO~oCݧwxU+ %I 5seڍ-;:\L> ,Na ƒmg r&=NTyQR֡Jt)y )S#y)mygfа8$G ٝ[*'Z\=h-Prj~ ܆%/ npBKj;CD;hdA{ɂ! [q V'UL(7LƿyKSWo}r[7O\GDsfb4VڠU)C롋<}ת_6{8ѻ*%ӷc-gP~A."1.%%ƦT,xq={r}-TN<\ y'v" Y],;S ݋̼ib5Ds$ڃ9Ecwr t;0Y554d-"r|\ /DoCTUOa۱>tu *Z:ާلkmiV )E{*'IYI&yYu B!a>m x1.ydovU0nΝW&wֽEg8-,gɮ0Z-Ap6P9b׾f^?r ' m>w"1y!g,n (S}fWnԔt})k0/|W|,p}MY*5 _M!#HL^y2&o7X>r 9tyV w E6lAǪ&Y;B5XHY<F-"GG`g^YS{;㹚H_PʻRt}%-Ms݃B"By(`F P8<C ;-)t_\PΝpr01&\$5Vp%&>֫ b^4H%Ns8 +qZ?"{/b?Fj뇞-jA-mmwbxS%zWy}WTn(mׄ钷{iܠfMSz1X IZ^,Je}>;(YSU>eZLMY U+egtA9ϑtAٯ]`tO빷~~ȨXZTY6ܷ1HAtƥu+>H'1ž)$/e!筩0/Z:ڢxDGuxHTxHisDbk% Z@sNgﺧ@כ>covvwz񞎣nnp<؎|n뱾cc fR|:<L+B[ZIPU c0σ6Қ/Ρʛ nuAC=@2CܐgH=kwE<gՖkyrgP評K< P^kʗ7izA1*wyޮZ= n歫]_Bj9&wevGuyf/QN|Y5^#/ Fi3cY~G(e|cQY6_.5HTQuK`LCI)2(JM ؊Ze4$>0-ALHKK!=Ya2bվ0Bx E$/q*j:^֥e@>5G!^Ĕ@u-)$H $B0 c p : hty;lwZ*.^溒NXqo `DS"u\+hݏfPJ Û>huIS_`:!E+/?rV_K͞RD5r]IjoK<9"0 3;.*6$KuHFFf˼UwU3xq;g1~&׉Y6t{ Ѻ"^%Gsz]YN/QH\ΨSK+gfc/#I8Jj0Lt٠Bcχ:i{IQL]ahRp_h雝1AD{Uz"Ij30Mepp_ l =""A9.>t{@U6lhVƘPNŭ{,MM47v9_  }sA{cZyωHD;:pwffn i4 Bc+ҥxӘj$0{9X $WQ6CD:j1ԔKk k4,K& alK:Y-b{ ĝ1iFxNV%2҈^x(vxk$ɘ,c0~Ozi355mT*:5mĪZo9z0]g}_*ÇÁ0y+ mRؐ#(xlA0r <[x$h'jG&n#% ]4ėC #B ߦ㟍jGBf xS QDڼ]=aɩjdJNkFm߶gupL:lz/Z,> y-~ӹXY2~"eU XQtO2_TbͷͭyL@^%tl<[CFk3m3H ʕ V'V)+kO7C!js0`vA%V;J5T%@km&2:վTK?WzHX@hNx*rEcn@^fo<^Ur{Ď,ڋӜ8.d⑞{ r~P`Ⓢ@k~ݳ L 'f>~h) s2hkšUwT弫V!kfaE]7"Z3۲Ci~xdsSl"bU` ci*h'_,إ>`I\gjZtվp{W? HVDؿ}C=]+k={VG\\WMsJ,m0-M1iM}s'ŭbR~YaXg`r֤:<~(VlgE2Zi85]YNe3x ޢM\u4םxjT֋SN24К~#t0# AHP@uu(! &.DaFϿGz{r:Os­4C)`mkuu[ԓ̸aWhH3κbxGEժ&AEsz/͑B]%γ*\ѩh5\~ lR~=I ˈ8{PAtOY GQKr_o0 SP0(O q&6Vem2 uBœ2jW*>dOߔxb\FmCQGJ3ZJr=Ub*,R9qNƒpS"xcZi{}jγ'JԔ4:}MymDm-h{l{jx1>}6ģ I3/ѣqX蠽+\Xxw\ dhvw|3:\n;~\Z#nw²N^ET:_޸]ǽZRiV)OR[QEl1̃%&+v,$<_0['9,p:Bf5up? bF)h8zaRi ;Ba>?;'sI4ww/R^Z 4bm u\A^u 9MOr3\xj 'kc;qwM:#-G"l K^Iur1'90ۙu8"0-G-qhhfMQ~*kUmGnhM$Z7=zڵ’S)ؑ.pXCQj@kx+0KQ岙t4HGt\g|_x\x.h@s {;./{<߀e_qi 7Wgzn?6 Z@_YeZeZeZy",.2-2-2-2N/-2-2-2-2-2-2-2-2-2-2-2-2K:R81K1 <2AGeBe*)Nwj8*lDe*{Pf~JKtL22kPw,ɒ,l䆺 q8ۑW%%UmPB)GMi6KS^%RRMiiJ)4M(e)Msٺ׆}!;w̜9sΑ0NXHXJ8‡.q_IIt3L'=It3L'=It3L'=]oEv]oECo#&_>}$԰qIP#pH[Pۯ ʤ!>=܂2<Qǚr2]ѨوcmlE[}ILI6]7BC6qhy ,2nm+L3^$ Sb?'D[cVіh 3IkE q׍0;+CM01iN,hy Ljm+Lh'uYE%7'>;mgqmg8!:3o863o863o8v-Sh8? ̄" J|0![!* BS~|+kmЎ"yzQ уIPnh@m^j)P{Po'Ycz 1Hvl2 d߅B(]a:𠐝\;^ew;xG>؟VȷvEQP YĻn7n|6LW:QCQSz;]['=Φ$ɢ!TDb ]И/ݏb/|dPA߈.ہOr\dCcCL 嘮亱q-S MDkOfvR#+G>XD(+"%XH\Y@=~OH2W:*HY /|nba.2e]h?J\:p-^DMRE񑇼w-ԏ(kG,*sućk|UPLb-Wnx1hiN?6LA _;6~~]sFέZ'~͎ b2<:⺢<\ ({۝4_x}:a~WQ^bdFf/nWN'̪zK!ÈEY42.j{ 9L ^ݴQu56G s9Uj1N׸(u1JH6/k|bYw'~fVXV^yc#82s"q{>< 1sX>}q1ϫp AwX`tֳXDED{5~n\>=Ĥǯni? |c݃Κѕ(6;SXeH_~ʷ+UX>3ĈGhG\ƯFӣ8v\8VN:]xz!d6G %qkG*W~y[f 5⌿[egub~*BU{5u x, v>ƞ|7b[ TFn1RJZWnE&qVŴՠBZb=KUBvyґlÈewºNWd*2/ FۣЬ3 ;bhO(v{f@4"DnW.0QcPa NX҉)e.@qh㋄0>F/R7FQ]KyKG M0k2 c}0q#Ѱ2f0k6E``$f']u\\cap$ P&%5A1^| S#)PZX؆>cpDq%؂.B˳ku>OЍ%+uzcd0*o&Q4zja\9r\tc0Om+W*@yXjQ/$ԉEi¢N6y#p: xEbWG|҈HS'ۃWMp;% P2;K1y[vxU3hD1|8D#+[MP\\RjFGâʪJֲ&o-P:k:p;* JYRjIIip( jZm}EyJ9>W߀z-DTlPA)[P娨Aֹ@u3ըLi,s8k+֕9ƅƆ*4_jkhjAUzT-BFi)#Se _ECRGRPWY˫geuU:UQWV@,[P6j@-[\SE^p637*d KsŵMUJрY8RWq-,ԊjDP FRYUV…Iײz9muΥ -ō/.>Flo|qLo|y >z7ƍ/0n|7P΍/2n|q㋌0~_3a5P"E'e~?"HSz@;ƾRuOYHU>)^ L^v^|r2V&˽Vy =Rg`+! ꭒ R2|Zʆ$Xm> A)+.xLz0jH`a _ccژ6 hFm g.m16~6~O6ٰ\q;(C Rю6hKh 16^@{086ECBچ8j;Qm8h#6zZmD{86h)|$چDd*0% 7z ؍6^COi|I-hCAS6l䡍BqhG]hmlB;h 86Π I/mRdQ6FdךIL>2$7}dL~ZnH Ƴk,7%CB&]eיHhž&=Ese/nxsċa| :ɠ?Д!7T|¨k,S}I2$S 빱ݯ,U;(,޷^9j&&HhSvyYvCx&JR+bW YFm"6(%攓@Dh׳sI\_ɈA66ύ5!A2z}tf]h00\nTg$h蹽ޘi^2 X99 iBLuY #%Ɉ}zd6l$.Bewk-9iyc5f9oW YXƋEa$K\G-r6LgՑH%qBaPXL%qk. uMv$Y& eeNfC KGLV,7Uw ]VdM5%S,-d `M( \>4n]($'IEKĨOs 4`܋BUJlJsjd&JVMkw3^ 2{Ym5Dܳs;thxֽa}j5KV8/WߧڊwJw[$$_`ى&z9I)0bx%R~h`Ćb:~J9TǎI7ˇN,ϵ[nIU$IqA@8Љ :$`L؋\b=@hO|. Z pG@ ya dRY2+BiŅRYm(-oGiGiw2-hS}:?M#4;<^f:?>K %t*й0Enyx໨-xޓF D\ ӸwGw` <Gs$KFL$MB9/0(%\H we^상ÏqO;\iD1wx^ _pQ2E.ohR`nܙDlP` |k_K8JV!~7 w?wx//?>xކ{t ws ,a#<818?KI#L]ҟR<4G-x^^Wp>lCv1s&=|9uv} jk`a-N= 6@d| cpA/|  /w`?㸳wi=,<$-Ó;c3!G5 gL胔M<#7_kfM6LaΘ!f4Nj% $'\KpSIV; w!|p`Hz!v{g /~&miل -3nVJ"L8Dx&1!pa~pڄ} n!Z'$M!ߊtC$|d 4E"E%O"'FXDXBx7a5a="[g&} n%AWoO&|ۄ$| SdB3a*bqJ64Y #\F""\Ap z;Rw!&d B+a*a&$Hg(:pa9a a=3iOpa/Z-Q]/L*~ƒ 'ޢVlG;ٸf~br-F_-]wIG] SԸbOc +w/$HXhh 㩡wL2~k|7'åSx AL+wեo9xs寽'zx[xgQi &]{g~KUq3ԍ'<[|Oxz5_#Տ)1<>Iq O ']S ++ UD85ARFuaua*&_.`!,x_:/dt3q7b@uPng^w+Zle *֫ 렒u A 8/x6x>ͼdOГ^g`;M'<}%A¿4\'\ ^V6vB2  aaap9aa/W>D}"a?# %\CZ ~p=W7>A1$&§7WY|Np3ҭr,>y<((GYuH7Wרkօt} A݋! YY_owW7ӿ?[Z!pKBIBu¢~ W 7|ds9:Fq)lZeژ؜؛6fd.4m7?`7Y4KRiqZ<߲Ͳ۲rrrjfZcsI֤ܤeI듶%J:k3ۚmm/ޱ?!yB̈́ &<7Y@w?HLqxR)))SNNuM=z,LEɞie%.ig''fO6q]'xjt}zZz~zqze3ݓMOHߑ'}8h g'#џ1#cOpьS3iřLOf4?s sG̣2gҲ򳊳*YhV@֎=YYGNegeggWf;={f>I)Ωqxr999;r 9s>W[[Fssrw={*|>/-/?82ϙɋ ۓ7w4TIIi3yGß58^88|VO;}KL]ܦ&5?ۦxܯNܯ#^l*pANn 9pťw8|ܭ}0tLA&& *S^VF|MT7{z5 ?ij__]O&:untXГ$g[#6,諜+{T{SMVApT"GЍ:+ =fAt KqTdR֩G3n ?_48H}K5| cτB{jl•}2pކw4|{x`|AK}Ӱ4AŜ =N#b"v"8숊QQ;N^u;y4(Ƹp-ۮn{~rQϖiB.N{EzW z//+D[Ӈv\]Y$V+o\BAblch3q4#-D/QqYR˯to ryֈ|Z[s$yL11Zl/yǓuR 4_WNjwxk(|x0d2 ZFm|Ɂl ߧ~lc0:]Qs.pȫMNA39mbl `&̂r|"֒E?~ӭs9zmZm31?h4x^{YcϮRd&mt wPK>66{ӿt眱2;<}^dqDƛ ϋrENAԴoZGtL\vF[b%EQ^%QI߶QZqcNw^+;›9}EQF z|ׯc 24D>z&Bk;u5kճ2TmHCzz6*q#{Gzk9.T_N ~/A<5}<( ߏr1ݹbD8$}AEXuZPa#~x^!;_E-="2YNmosj+GiSjDzoUwkhvp qxj0Ҩ"=3:.GGτwcfib **/.W~)Zx3bX+{bG[b;Ro#Q Gz^LN-0*[];KsYT w3N7$ O;<_P>7%]n{( g7%(0GP^%,}5V2 d$v0FQJ4hj($맔/ SdNOP^m%KH^AyE}h2M1}'̕lbl z w܄{)9_P$o4j!?ݐRq1?K ! &%M<:J>]ë?]m>_uʐ 465=j>7M-UyZ"MKL:RT'6ߴYUi^+A+5 }夆WߜgiXj BOSf[RSԱ||V*iOWO)jPϨi! \ß|Qzh䌚_?>_ U9~U9U5g9gPr>5?iZ-UnTK~̤7wjJ5ZjVWr5~5jָ}^/n W?*^t_S?zpKOBH )x' Zkm6d;tNw[ۙ9Uf?d . 1m!b]([dy:tا ~[:vݰ^A0p[Zcu Z΀NN{H'"[lo1m'@I%S}=ԇ:k=]i+ԫ7!z+oѕ lw>'gq/Eqi"mK|Ug` 6V O)r lt#'iy<Er#|]ʝOaH{u!y%~dJ(vU~+!DDDMd1BD MDDdY"!o" K}_d_,n33s~w eCR!,c& 5(eHBerA5` ǔ//RF -mdDA55ct2:чFgZXozvSz~ǡ4Uuy7}nn~ `W$X^y/x>y(y"" ʂp,, CVYTl,, eYd, Ѳ,9eYrɊ"-+J[XGV!*½2^C^\6dKV/_@~|d( ;NPPv|]eO7PT-߆beJȁr "@i9T2rrȑr$<$GPV&$('qP^a9AN 2Y&#r 94$Sd <&_@R~ ˯WPYΒ o7LiPU. \$AuD.r\5 ^~O5r Ԗ?\/C]Qnzr6h w]>GG0퍆A^{q0y 0Ko7zӼi0KR`7ݛz30›̈́T/Fz0ʛ́\o.Ҽ4H{K`[ U(PS LSB LTR\U+OyP0Cݥ/U6 f*;|rr0K-VaZjZsJQ*V0OUk!MS[Am*]Ymj vj',QnXLWa: uX: ߩ8R'I^Vau&Œ0amav "G Y"@zDֈ)"2"6GDEDh+"lGq?x Q0] `~oz^7,ehn4Z#Qye>_dYL!YN>,,勲|Id{ eC};]9@aC%ȱc('OT.gș2UΖs<_QJjVd,ʝ<%` ?G+?jƴe^*,5O6?@7[}SDB\4/-DK4VuhFЎ+u:S :.+:IzOӵt3ݍ[NKxZ XUeXUV5dMX+֞uaX_6 !Xxx}JxM xMx},<5YJҼ&h^S4/^3^_f x xߜ7y׷E%e^5Tj55^^^^M-mAm  x xxx x xҼi^uռNNN~ xx]x] x] x]x] x] x]xev#M242;yԼi^WVېXOOCKx t:t?j > p318'$pԏp·Z5 ZCG|_ M o(u`i-̇bXKafU}A=/~yBH5|⋐ z@D`nK Ĺ; (f޻M.C0_#"qc1"oeIHɘ?5^q&D<$LA `-o Lj1'#1$ jD(=K ;4z=~G+Yd0FF;6Oe>'sY!2 #ɇ9ϑdMƐ$X}7$Id2L!S4I! 2|IfH*Ef K4-OdYLdYNV;|OV5d-#Md3Bmd;Av]d7C}d?9@C09Bc89㇜&gY#9GΓ "D.+*F r;euX]VgϰY'cqyֈ5:.fE֜%5Z6e֖5ƫXyt`fmev]l7}l?;!vaG1vlvbvαX\dev]eun`"1N`A@]++/GXL/KLfװZ6B:lͰkmvNaWzo|̷|w||?̏?O?G~E~_WU~_6Dx\TO*IQUTE QS<%jEmQGD}h  s"NC01\|(FH1JcD+Ɖx i3">bR_T1K_91Wi[1_, "X,K2\+wb^kZX'֋ bHfElvCnG~q@aqDqqBiqFeqE\u!nXĢbHd"~yqA\د]7nvwei߲o}7nNwvr8}w~λN=g3 vF:'s>v;8N3ə|Lq:9)t g3֙,p:gYq:?8glv8!s9q~t9 Esٹ\u9 e.5\wCa{=wO'Si{=w/Ke{ս^w3aa0a3,V8N 2U8"%|W8k8[82= ''|o8opQ1OIɘw͜ճ=XTu~ աOA- yM+hNT7.C>#~QVZmi9,rTg/O3emش EKYR =,J2!~Ř=eWؗX)=OLϐ&kb1L+O( ì ƞ?g)Q^Uf_QҀXXēxT`H~AZ4p&Lpi &g9- ۜUz& -nC.k>2%FL:z(%Bo[r-)lݿI??>^Mwa\.*>zXS+UTAZʗ{-~uZK5ݩmJwKPF6ߩxaeU_SƪrPS\Ŋ9&t=1+k`O}7uSMtfqrH7pݜn.n7{ǽsw܂n_Uҷ]KeH]:헚*=d/uYuկ*&-6gH]T\%s??]j?ާ)pM 6O@ xڂ/їHiښ&e }v%ei7:T#OkH3֑%,u'XO&bػl gC0}7#6agI,$ YX YI2DB!2 @q2JBe2_,kQ#ˆQa\2.hq41`49mo~@s96ǚShqs9>lKies>c4bn/;]*u¼[ĈlxYBtU*NY%tcV9]aU*ҕV%Ίb*U~oUVM&]cշӵֳֳ+Ίz՚n`n/ҭv nn;NǰnEc-=o/ 934vXw/Gz]$gYoL[[R'$/hZe铴O (?v65F.n#qǸkg37F!Q(j3%F)4]O7Ѝ4nnzz9p"\p5p_ _kKɥ߲Q'16?AoJVMzuQQnZ8nkN4v:|.*=s;~l?[5S48)GXI*X a_i_~Cjkз׷s{=ҞieCa}>nOڧǙr!3ߑ5jMp|?Xw )X4I+*H= UnW ٖN !YsV` ʄcT'F6.KFYbaTpј5&6Ƨqf|X-v a99"qۃx8JB=ErX%gߒ"3% *`v:Afc "_!s-o=ئ%5-Utfl>T#J,#he>yԘfy[JcGܥQ/ Ђ Eb/6bC%666eоHDۜƠmABے+th_OmKD*=?/?}D8ʣ1ͺWu+ >7|>wk|&XQxOt|'NOQ.3 ̉c${=obO^h/K2{(ɥ!M)e_Wku;þ:s88CapCgrf;_;so<'lwv:~s9wN:p-7ڮnؕvEbnq[-v˸1CnY[}ح>Vtu+ne ʰ2KfeyE改zƅYG5P۰ ,U;Nz%s'QF|_,tr9˜E͋$ҟ' yi R:_ qg *|Mgͼfz6dX^1.F]l[s{}糘g05";'ǐ| ^{`;n_7S:X ԣ="]dw"̵j|߈T_2b8ʧ bAReU9U^=WzRUUTuUCR}.b48}T͟X*l/Fꙺ) M!&&~T3#jCLVBl޾^#^'J TwՓD7UoCQ}HNW#@5ܣF Jx ۚT-ZW#3RDũƤzUR PH)mmV ?*^oxpgnyI A7#D AWyD3>>K}Ϊ}Φ}>Gks{$-?ўO%g;AM}"R~r|=au}|tBGiͬ?qi /8{+cԵ74U8҄S-z7|uU(xOcO~+O"*==x}?_*?+[RptۯE?қ "[mo§c]>W*T^w~ƿFsgi!{ {a;z ~K분?gsn4oj 2_e+5d'譙G(42jk[ǷmY&?*d❞`KVI@N&ITcS {x9S+9?7o;y6xŒ}F%.y [h8M44t'=HO 4LHgX ȪZx7?U4xh z@_! !R! jHpN&b]lfBli5;"7n]^f_>fs0 s9qdN@oN6S3و\s!|s qLG`n5w#4G'sgKf5E@YE1($J eDyIJ+Z5E]h$!6-E[6HDL]E/O C" q/&#&ibt*"RbXZl[7b?^qXD X cr?dq@y@ < yȣ@(@d @&d"@&d@& d )@ d*@ǀL2 4 ӁL2 32L 32 , 2 s2\ s2< 2H  )@Yd@YdE@Y d1@4, K,2 ˀ, g<d9@Yd@,gJ  j  kZ 뀬H*T @Yd= @6d#@6dM@6 d3-@d+@dm@d;@v19 HIToP7FԄSkjOM{3Ȳ9%Boch&œz;]VtV.oc)zP_w8z#.3ZLhvӝ^1}7ʾ@D 1ccvxe@F;L;@9QYF}sQ|SP_r(F 3r9+QBkQÕGF[(*~bLkwJP4K"B|'_o [M=]'| M$)J{3xxܧe>y&*6*4cژvlkB9)]}:cbW2 yfa=+$b OQye^XkV0^f̉I5jqz¢ژeVϟm^^5cYmc}>; |^CC,϶> .39<~/g+V)>S>{s߬Wf>]!|\u/oBd 1_ϭG )\le&DƆԄZR٦AX8*svg{ faW;4{P4vS\ZWžBpD'.cE+Իn\mP-QozW\cKz+5E{.YA{;N@:.hE6.qCDEkWk F_Q F.GAbnGg(7b]XUv}FW/T}3.@KQ.z:2zLG ӱ[sU"p7?6Kk1 < lG-[k o#G2^Y/+*x=W`0*4 mj2oEgN] Ab"C01\QlUlS<'v E-^{+2Jf2&2%s<WȠRJ%b,!KR,#xYNdE oMY6FVX&eSL6-dK9B%#=r-{}r|LN'r\$˧%/Kr|Y~-I*JeQ*AS7&@ݬ[T#ujnSMjjAjTC0^WƩ*E-POjZVKx-[F]Pjگw{}uP}GcT}>W_XOtA}. 8]Dtq]Bԥti]VtU=^zfE^ ī]+,Be%YjV 5R9CΦr\E= tʦbijZdNu).MjVKrZ6ʹ6 yU_ôCe-ۺNfo+^^}55:Ex}t{`u.RX(iD,3bX!+*Zk:*~?_į78,C'IqJd@9Py*r('r*S\(7r*r)?ɏ'S\~!_ J|-ߊL]e7]=e/[wȾ!_|Ts\9OΗVr 7ʽr/w{}yP~ #<&U>_Pյ*TUTSU URRUUVūrJV]U7]P=U/5RݣFj&)jzLMS' GRGQuL:I[:tl:mvo{{E1?73c54g'ꦼn͸pf[o }GYEN3Kl v\lRQ@(" {"yLEUDuTL$P qhDDcqMFxǩw26/ s=Fst13i87"=†6+A1bZ6Bٛl&#3Y S q%їvҥeh؆(pO2bmoF} Qav@_Kyy]eZڒԒW ԊWԚW/{ 4WjoGuc݆=էt^JK)tZntfYs6yf.}ck߸|? ؞}>54wSn{AhqYo'osXŹ/jS!G7JܛwƆVh"(оP/nvO&]ycѤ-_GY@,2QV:Yrڲ.zl#I@b˳ 9lu6|lslCCT_7;IտQ}B.eglv;˾Vm۱cv!].fKڥ2vY`W+UvoͷzxOO0soAw0}] %bޕxߋɼ]!jiU'c˼on[Gi΍qMCS̹.2Uc蝡4u{&-5=TUf\Hr\BTUחU[پS/fr&7fr\V^ciJr\ږzn{[Ȋs*rbnyUڭ&ZnU7*Vw*Jn]{[ߪ춱fi5+a;L4)pO9 pOy 4ܓm'pO ដJ)pO TosEmh#E>_ĉb"ATDuQS7VD.n~Rn{>'hMWVb˂ز;* [;XƋ&%[?ؗ.*G/L>&S7}se%t7Sqcي_gk[7}z><nnku+vV{[v [rn9&X]n+٭V5Vw[sYܛVoκy{V]=k@l\֠W$W3yZ,%0T>HK|%A} aKȘ 0e˰, ōy.j-vD#;TC4tlTԭtk}v-%­玈6.u~&E#ݘ{ƂpN[ŠV#ꤦ8ƃ w(̟2K&˾h%KV~wjX!mWcQsFO׆#iP>COgyi#ZAQca@{=bi{=Şj?fO3#3dCCYϛgSX:ٸ<ߥ0ZCk uyy9YLѱ^@l=]z ؜+C CM/X)53*if12b Ř 'QM#CNu.yc4wf_4(l e)h&[Bbޢ}+,g[?|Dž-mRihG0^Y׿|Fb~ػ}N>?׿S3)}q$=e\+'~} 'b,;LuN36h< ow[ >Ӟy+d1vx}]þncw; 0^io߲ٿ8sEγNyy9ӵ銱ó4;+lq'؎*֋WxIbUX^N`{:K :;7[; /w4\ &#ʢjIx,l UlM?]6zA["X}4.c4o Z\#V3x la pO{kR׼~0shNZ>$RQUnϣNEتyZ]s 7s M Ku쩅 & t Ϭ gux#CmXXW(b=/ ΢T>ޠRI~ehU-M'{hɚF am譁zkH8 u9OS ${Gӻn*irs;ហ1xῒQ#;7y)8{ST(k絣j@o Uศa3}Ia }JѦ_һ;zCD9N'ǹ8AG8ю(t ;qNS)4qnw9-6N[tv8N7s;Ng3x&F9 /fYbiW~E^cRQB{^_Pңi^2]FVcT#GdK3He*4Y#Գ~2r~f~52TYY-FIordYY=Y99Y( α@svZWJFHp%QoMGWY;%t;風OK+&ӱ:C 1}ʡb(E"KXed).+ ݜb.,nNtkݚnjU|VeroUUg(^\B`pf0[("{6Y&DH6br6Xoי>CޯwoF>ceg<׎AO"ڞkC{ vEM=Yl{^f?^*{^gMfU5߶]{?ؿؿڿۇ#Q}GNhHc9+O3^BJ_jk 6:==YIT4=-pOK{C|B U0{܊)-sO+>AA%PPg ^( \Qo 2Tu|͇`f'(9zDpH!ʾÞAy\Goiwo]*]WsKwqydF[MVU{E=_ю"3; }9ѿdĝ炙33ۇFIs}L)9bvCoCoL* ҽ{ Ļk.}ׁSlspsnsc;_hv<Lkr,aZP³x[GQV+EeQtFxB2vCocvt[YiUuN[?3J2wUpq"`Jr /ĥo% qN.\xWmX*6e/J{ÒEhRL+u0(5ߡtL2:M륶nCiQ,|fx'bs/^՜2b$1Q,F\ KRõ]چXk_õ] QL OߊUbcƆۍ on]Ӌޟ~%jes&>$ ^3xE +g6$.fY&>L|=|A=.c!٦cd,Vn]c)tqU*mUYeeŞ1S[zVC.ZMlb䲥՞V2V/.{Yo\m8.Yp5YP5'\ζ;bU׺lNCe ?oo3ᮗp[ no_߀|èGP?C=@}ԏ~Bߙ QύG[z꟡gE Գ5Mˉ8%oP~c\]%P~eJ/585k+ةLwkaE;ƝB.x3 f=Jz ;7&hƢ sscփlpWkTDEx#;/לqn;?qn(9ȣt*2eG4!s:/2+ȜȜ .FFpq:|U͇ݜ,`ͫ{=y4> ])ב4^SY:52 9/O _w&ug#_)>ILƬ2f2f2fc11[qr:rFo1T`bܟ_Q{ҳe{9\1>OyNs9,ޛ#xkC;tpxyǫDAy,4TgfB^ӭy~.|wq5]ۮc`7[حvg;jw=v=;9c e0ͰI x3_rY2p{hsN9!NI;ƒ_~ xךs5Ve5ՃsqMک+g߁St9}jN5s+ sy|'Y<,t9%RgYS̸’px~8鼧>]HN|*s3yz9?}#l䭚'=J!*gdڻDR҄琦Mg= |#iAϾmHkzLngT҆lLq_ҞiG ϱ?,ȸcFe,1xkկC>$wMkZI!<>Yz1r?wVM5[")B . O O ?~+Ih/2-3\<>8=Jȣ㑯Vzg{zPB?=]x񼱑n6bgG$3q8A,Ng8O\(>*.׈//-vqx@PLB#zjxdOxzZyy:yzxyz2=d4,σSYYYYygg[IjH)"ER=Hj&H.R4XJri4E%͑JHZ*-VII륍ҫi[: }"}!}땼IހWx{y[yy;yz{yxz9ޱ 9y^q Zz+׽۽ǽK|_]_oo(e/7W+M[{oo˾M}}{}NN%H 5HB4vB Z&K#a@ Y ֝O G`fR0.GrWqDDIHH/2rFr#d嘄gb\R|S@y\yisV, FaL5h9o[|F3AzOltAП  k/ 'b1|2rfȕc@֊TފT"HE+RъT""VVhE*Z[CϠ5@Τ{>=tBt0W>ꉥ{"ǖɗ{bX'{{u^eS:Ƨ٧`Sy`肙 [tqN)\t,O-<GG臒~j?r \Ԟl0:t՞ksyvV8"ߕ#dX,=/=SJgnW4Xt>z)䣗#"rpX ڠ e ^J>P PCj(@.6$\ .K2Pk(5a_a_!7ǁ8d".ƣ({5O|*ATQ~PEU?*x?*x?*-%U%~ZAKx?5~PU~PEU?X[.ϟOU͟?7{*7X'(u DcqQlcL65J)Tc1ݘao40fR̘c0rA\!c1Xcq??{ׅz-zZ]3~:~}5Ѹ猵 埾^_xYB™G;}Cz'34zoXgqu DϹ3tz}gW[XPokr^ /~MP5A y&h5AM\_`k+^kBW3.pޭNOߥ2Ffj]=Xb0PĪFF}S51jPP>"VަZ?2w항FH 3ӟ__%!MIGDF[g%GO*V֯'\s'ЭNu?2nÑ7_#"8wjl:$iNʣ z0YNJȃYHFd)$d~ܻGϴ>~{oZw/d66N}t&fѿtO'ugܻ\ylkԎ?G2!.sXRD)47d|1/Ra)<|m>3[lJ[LLGDoH[-LMYEaY+,A P,Ǭ9=zmoO[ߘӘZՇ,1*mg׆؈_ W8}LgŚJ2ZUeREE #wE"FJ"E(-x]+D`gȢ|bpq_9ٙ)|%!$18-8DdьJD贪RݞZ=\K3smy謕vDOϥ$-[P?,{k/Y6>2WZJӶmߗZs='d~?>~YC^ /Mz҅$ a:~/Ⱦ6|sx] ~jdudUT$u~11f\p48g,#bX5kt$tdk~XfMh+RÙspXRFN~1 *bT#tMfzG{z r\O/' |DN^n! ($;;arLj%.N\E&I|4MGUd*O"y#GɋOGG1IWwI>9)IѤ?I%%rMO>/䈬QccggtƋ'."$q}+f~#OTJv!x gQ}^_U/| ,}rF>oMJ)ЁN@X$zmMAEZEϚ+)&nӥ^p ` l ^67i`JNF 8}B-䳶mВ`[%${Y)\Bx\X!^^6 [~C3 >1I xXWL{)=>ڈ.bz őhP$3RAq>f[&׊ōUϳo=VӬꉶ^x+3S)L؞EU<h.  <|?x09Z-7on n=NpGlҸheh6n2mv?Zr~;i;ش'Rn&n2Մڼ;qqw{{?(.(.q\q忈?}ވ&ۄEoK3z<^,{ǭd7ݓt_ʧ[=ZvPԠPw?9yOw\<ӽOԋKK:ej]j=rIVT qq~MYcq-ڵ,dhyЊӡUՑy+bG&E b6_ HXGܫ()S4e2C_m6UMfhk3YlT+hw "iejõ,m6IGiI=1F:9bI3r=xرOLDjdWEjU۩7jGzYMrxWj:N-TRu:IjCXJ=d^DCoWC⢌eu:S}RLGkbsBuXPQ! 2Iu9b=Yumd/Կ/S7W_QnR8eo Z[qvVY_}O=T?P?T?R"az񾾌o[DZmMۨ^mK۬Nu[76mC{W۩vk{Aq8b5__Ǎ>Z￰}{6>J9oQ%>[r}:W~_6V ;[7>"w Q':w>5/ 60o>c0~Z Wmv8iN;pځv8iN;pځv8iN;pځv8iN;pځv8iN;pځv8iN;pځv8iN;pځv8iN;pځv8iN;pځvguڅ.v ]8iNpڅ.v ]8iNpڅ.v ]8iNpڅ.v ]8iNpڅ.v ]8iNpڅ.v ]8iNpڅ.v ]8iNpڅ.v ]8iNpڅ.v ]8iNpڅ.vNQh {BQA?x(0*hQ"x1x)X^&W 5`c:loۀm-`'V3xL` {}@bF@l(p[8b GQlhd[w-8mi N[pڂ-8mi N[pڂ-8mi N[pڂ-8mi N[pڂ-8mi N[pڂ-8mi N[pڂ-8mi N[pڂ-8mi N[pڂ-8mi N[pڂ-8O'm8miNpچ6 m8miNpچ6 m8miNpچ6 m8miNpچ6 m8miNpچ6 m8miNpچ6 m8miNpچ6 m8miNpچ6 m8miNpچ6 m8mi(_z iMKEd)YNV!+~z|+HU *1Ja<>rUFKbG 쿷GBi/zIh5{$D!p-И U` 8z=w  +e-1 | LgL>4BEzZ NĴ,&(5cp6GI^?/iOYRcQ=bݢ*ŢyiE~d($9Qb=+1{^HB9q̐PìލJcSsp82%dd6/!QB6JF ٴ5&$)iIףJzNvFxmmi$^n:&LYzzs)g|6>?M??_Os٬P)='"sI$rBA3$o~xgیm8z2ge8p8++]\.\,/K͚Ocd"?gtqVƏ2ge8qf:,^30GI^?/iO-gxϏ2~8+;-jn02~煨P]ĄCϾcavC{2)'crA{e$,ż:ʙNǀ .j:k:(j:HgOk // / /a(iG0LyHf,W<2' o (iuqx?ܥ,]yyauw]6ήx&w&Cbݰ[Ct),2er.Nyևq{ID $J@ 6.e "Fc"nÇ>=3όG8B8ʡG7nGC+B(!rrPVZ!"Bh G‘lku)/gc֏'36/#I.GU`{H`k ]?9xՏ>W˧mZ k9|t^ނo~#~?<ރg>@QW.Fڤ,5&>OyKI@~RxSfl٧ħVǓOW`=X?QO?H{)9JHOP x'ûq1"#+{x.  [-\~}#Uı Xq8VA̴8VgX=o~7 gN}]͟ s wwpmp.Ok-?loǀ`@}k\UWp@:%ҿHF:+O9g\ժ@p6-tkk?K5,?+f4o~7\ULBЂpC!AFC*Ƥ < C@9Q/$0ۄe_| k73J<[{Yf6@m#ܑ-o5]k(_P`W + STReί?nI'z43|?@w0/*Cjyt"O>2Ŀb Dfyd YE֑MdC#9C.+<?P%Q#jC=(h@:mF[v 3[#8:΢ 2n[)z^&"L }3t1tA%t]G7mt=@ @[ B(pČ ` bFkڱ.alǦYl[ְ l C;αKId"T%eOʰyl [ֱMl#;.+Vd2Xp)3l2BV-5ʚevYG/ Fd)٬lA,[mȶd;}١Xv*;]ʮewr<_^$19!!T^)˛-P@v$;.dW[9$ϓa9"(=rF3 yN(o]y|P>,˧|M!ߒc\~))$|EBR §+REFQhR(nEb@\*S@O1~5~(EJSJJI+J2L(KeI٢lSv(s rB9S.*W/7ʷwPZYlT6+[.e_9V(ǕSYrYPn)wCTyT^+ OR#"hA0 JJ' ^bxN F b#%xMo;=H\U*#z~b&Fqb%eb b8$S✸$;D*RIUPQ*ZPTaUBUTըUMUCխU ^FUi՜jQzzzUQUSW}P}TݨչuD-WzER2լjAZSmT;}աXu:W]Uwj:_]15ԴڡꄺT]Q׫-6u[ݫP?WP'9zERJZ~~~~Qkr5bMFQkƥ h\S4hAe}X}>W_w&_Sj0 4ơišTSk4-6M[ӫ<׼Ќj&4Ӛ9͢fERJZyyyyܓdYLrRMI "dLdYK6|J!LsGJ|IIGYJV5d=DmdMs9JNH/Wkr|C%ߑGj \KF)mJ[m>>>vjjϴCZN;hKULKiiCӆ mR[6i[mmW;}}NhsEvWFVN^AQ{r*䔚SE(ʩ*jQ'T'꣞QCGQ 5O-Q:ImS{uD@eT%UCSMT FuPT/5@=^P5MQ zEv7[@}n{]@W+uj^gѹt]Tҕt#c]OL7tcI݌n^[խ6uۺ=݁Hw;]tzH/tݺ^݀nT7u+W׺][;{Gݍ^/KrZ[.}@է*}AHXDߩ?9~R?/WM~O?ҟ+2 1`4 L?/W/7w!P`(6Ao\!jH UZCቡgxf2p1äa0oX2 mÞpd81. W[#d3a#bčh=F3 cv o o   7{cXl,1ʍjh1cԘ2#cc8dcIq޸d\57=xb<3^&Ȕg*4&ĄHd3yL5eLjSlj5L=~ Tf1ޛrMbSInR&e Te55:MOM}g!g3MfL%Ӫiݴi6LGәte!:.aq Fn.azYz^h5-Q:EUt-@?ON)G?h'z^Wuzަ> 5CbOg e}þe߱S~msH"ԁ9v$JGhq9:ݎ^Tf: G; Fq0֑qT8uFGr8aLjc1u,8k ǖcDZ8t;NKǵ)q;R'$v:>gؙp:+5zgpv;{Qs9\ʜt68YgYv9Vgw:#qsֹ\v97[yw_w'Sz0 R_Wk|n_o7M|K+k߮w%~_-~?Sr?AeKߵ/R?';>؟+5zw{Q?____woo7@n P( >` @4 @gi/,0cL`* `"@# @i2P4Zm@w70xx LsJeUu`7&6.>!1p <ꃖ+F`y*Xl> >> vςCA.8 Kzp3 @eD4X -`G;>'bp%2*:|||| 3LS̔0rF bLI1LS40y1Ϙ!cƘIfgUfd=9bN3悹bnCTƴ1L7 0ϙ(3L3s"¼d^1] yǼg>0>*JB:YBP  B塪Pm!(8$z = Xh24-VCvh/t: Bm p a2lBth.Z ބކޅއ>>nBpA8\a}vh8.Wk G'p_Yx(̅“|x)^o{Q$|_o#P$/R#HcDD*"PYUux7&6.>!1|F "ő<#+D#Hy*Ri<<D>Fn"hA8ZGQ}uEh4-VEk G'h_Yt(EǢљ|t)]nF{уQ$z^EocP,/VcH 1cĘ*bձXc9kuzbpl$6BeF|+ߏƏe:~ǟ;O}g8Ogj|=ߎGY"~M@DaN O_wI&?Sf 2tƑe™D4Sg2-LG;ӛ<ϼȌf&2pP{%|?jpP{ #P{#P{j0B~(o#Gj|&0+#,̺JBV GX#aR= lj0 GX aP{HNj¼+*}pP= ,=-Ta%pN G8#2 GB=jpP{+jO=5BP{k#,̛N=*zP{ltj¼.p#,pP{Do#K GWBjP{D-1H=b9BG3 Gs( EAѠhP4( EAѠhP4( EAѠhP4( EAѠhP4( EAѠhP4( EAѠhP4( EAѠhP4( EAѠhP4( E? b_@k 5} ľb_@k 5} ľb_@k 5} ľ4 HHx~E>93癏<)Y|緑/x~,By#_ ׈y!R³AyCdB/ >D1@ $U@4Z6@; `0V~ Հ>`-`#6 Do x +;{_ @ g3e@9id@9id@9id@9id@9id@9id@9id@9id@9id@9id@9id@9id@9id@9id@9id@9id@9id@9id@91h Y,td: 2΂LgA Y,td: 2΂LgA Y,td: 2΂LgA Y,td: 2΂LgA Y,td: 2΂LgA Y,td: 2΂LgA Y,tdw}~?3c~n=̙3OggS"_~=zכ_|}G+DQ JTZQ(hZ֡h ڎv:yBgϛ*n{!zW->wf]9ެ|#8_/Wk&~+G?/- j>V>ɧQ~_ʯW~;S<o9?|`,,r0#05f bq+ʰJǚVAllDz1 `JLY1(aXVaX ֎ua6cS 6-aa v]ab ]%BvGbARP#4 ZnA`P0"0Y`Y&GHDy"ABP-4 Z.A`@0,L f%`C- N+A,x|,<sp'p5nq/JǛVA||_5|#;!xވxދ8>o~~?+!d ӅY!.$jQhzAa\X , +5zaU! # !#.kMp_x$<^wG7qDϣJ$ɑ|p\8% pOx(< U!bEY."DjQdyDAQ\T **E5zQU!E# #-EkMюh_t$:]EwG7ћsR,ZYaqmE{Cщ\t%=E1K.q1!Vb#qL\)׋ĭqO<(OxA,^ow#B|-?$#ɐ|D.J' Kr%IJR+i4Kڐ|A,~HXtI$GKZb%IPH%eJI^$itH%}AɈdBHf% eɚdS#ٗIN%kɝQM&EimC*ʥZYaiPZ"-VIk fiS#IǤi$_%͑RBvGƥbiRZ#6I[nitP:"2YtY&ݔHGSZz'}~!2"BNh 3$|D% "jh#:"ƈIb#b"v$A"NDQIDJtD1HC 2Fl;>qD5qG<߈7"2do2L.2' reYJV+k5dYlH6&MdٺlK+;dٽIjd&YC- Fd2F6+[-dپHv*]do79"3or\.r'syJ^+o7y|H>&O|K+?I"W(LESH||D>!g|M)ߑˏ N(&S "CS B* §+rEJQhP4+EbH1TL+źbK8P+ŽIxW(LeSJJ^iUJJU!5ŦbG8R*.׊;ţM(9ʌϺ*EJR4+J2U*K*eA٬lSv*{!rR9S.*W-@yPԗI~פhLMH4J^cՐJi4 MNӨiѴk4Ͱf\3k4 Ͷf85>MX)Ԕh5UZMYӦh5C1ͤfZ3YԬh5[]́Xsh5Oͻ6EfjVUjZRڨ6O[-VhuFm]ۥh)v^]nh{C\{>h|mV۠mֶi;=~vL;i+uvW{=֞i/7{EKqul:Ϊ#u.Juj]QעkuzuaݸnJ7-VumݞPw;]nugݫCҧ9ztcIݴnN[ѭtݱLwt/w}g1DV=Q}H_W}K߫S~IoJ?_!ݐe1 6 v4đ|~]gK^ѿR \C!ۀ$AoHe ERCPgh4 ]^Àa0n2 KUÆa۰g84 W[Ãj0,c7Fh=Ơ1n,0ˌc 7\n 'Ëݘb3F(1*zH)cԘg,2+:cn2qq8o\27=xn2W㇉eJ7erL0MF1MqSTf4՘MMVSg4&|הi6a&Iiқ&D,s9˜c̈́Ym6f9h 2s\on2;>y[_6-ݖe˱6¦mvmb[Vc5Zmn[m6b1Yۂmٶf۴mGSۅvg{};ǞaEv]k7۝v=ۖl ۶mvh;ۮl۳agY;n'jn{A{^`/+5z{a# ;c/ؗkM}~d?_دwG7qpurav8>Gؑ(t8UZGo?_ogr;9A88Q(sT:j&Gs :F1Xp,;Ǿqp\;o7'83<'9Nt:}ΰ3Y,q;gq;cHLwf9spFqqgYt8MVgt8'sֹ\v97;}yv9ߜo.qex.%r]Zt\aWU*wUj] fWw \iלkѵZwm!.򸂮U*sUj\&Ws F\.5Zp-\׾up]\o7!9d#QRDI-i& d!YBUd-@6md'CC9INs"B[.y@g%yC#dYI֐dJvd9H$CΒ 2Fn;>yD5yG>773<7nv};].qܵwqcI{ν^qܻ}q߻/wOd#nw{=p3Y{ٽtGS}~tsyǓyP#h=f=BOS4x=mNO3Lz=sEϊgݳx=gKύy{S\o7ۋy%^WzI/{<˞5Ϧgdz9z.<מ;ϣ͋x9 /ϋzE^W5{^7zK*omvz{!w;.zW-{=^zo'ݗ2}>')}zG(_ԗ+*|վ:${^{/o72|<>s|/W+|_|cIߴoη[|߱w|/wg1įV?Q_W#~gy~/Za_/Wk fiѿ_owc?_T ť2l $SV(*JQET)UAUSuT#BS]T/5@ S5CSK*SZL9)rB*ZjڨN꧆1jEjZ]:ΨKꆺ=2, (5@@4( *Ձ@c% ÁT`&0X 6ہa$p "@y*Ph4@`(0 Lz`+8})x`v Jʠ>h A* `u.l pp<8 vp/x< s5bCYH~3ǂ\p1\nwY2x>_7a!IH҇!2DPQ4TՅC-PW74B3Rh5C'U6z>¬pz8+DX6a -VB롭n t: ]nBK=3a,, +5Lp4. +pc% Tx&<^ 7a$| ߆GIdEr"x#ƈ=#HA8R Y2|?_7Ɏ`IDG2BEHQ4RE#-HW72G"3Rd5َE#'U6yF>hz4+ţDT5FQO4G Ѳhe&ZmF;Ѿ yDhvJʨ>jQ*Eъhu.mGсpt<:Gэvt/z=Gчs5ccY#b1fybXxz<+D\7qO< xe&^o;`|$>gr|-߉Ǐ5XzxiM,=K/=2KXzx?J,='/KXzxhbKK,= 'x>y{H9I9OJMyHyNyMHefD:՘jOSũe5Mݩ}#LlBrZfN~QiEu]c72X<,-r|0+U*aXV3aXcI4kZaX1uɺaݳX/wv dg1dV6ɦQv]ʮ`W؍v;`S<{`o؇9}~`?_'9v9bNSé4qZ9nNg3™0Ygp9GSsy|㼥!i4^&Jii4_Z8-70$<*6!9-3'?m(m,m2m:m.m1m%m=m+m7 8,2&>)%흛r3\+*zKr)n-r+:n#rqw;]r7=!{νrWwҿ.s@D "3_PRrQ)C5B moOjxb_03?f  D| q(He@9PT @#4-@+@'$n~  _0,C`!E, Rˀ,X `%7UV1Ν)K3Mh*d@@P0P0P0P0P0P0P0P0P0P0P0P P @0P0P0P0P0P0P0P0PpPp 0 @OPOPOPOPOPOPOPOPOPOПX'z?6ρMl/lk`;;  n{ #`??830G1ǁ%ps/4pg8y.#pK \ W jz)qS㦠%KC_pJ`pJ`pJ`pJ`pJ`~YYYYYYYYYYYb9nF߻ ݈nDC7ЍhF4t# ݈nDC7ЍhF4t# ݈nDC7ЍhF4t# ݈nDC7ЍhF4t# ݈nDC7ЍhF4t# ݈nDC7ЍhF4t# ݈nٻX;29ljK\}sM !1f2 - $ĉޮ{׋{'ZD!ĮY2,e}e32bF?"os8o*lTa UبF6Q*lTa UبF6Q*lTa UبF6Q*lTa UبF6jU*lTa UبF6Q*lTa UبF6Q*lTa UبF6Q*lTa UبF6Q*lTa UبF6Q*lTa UبF6Q*lTa UبF6Q*lTa UبF6Q*lTa UبF6Q*lTa UبF6Q*lԳtH't Jt3,:Ρs<:. ".K2+*k:n&n[6;.{>!z=[UQM QO4Lc8=AOS4=Cs<@/K2m٨FU*lTa UبF6Q*lTa UبF6Q*lTa UبF6Q*lTa =Q*lT٨F)lF )lF )lF )lF )lF )lF )lF )lF )lF )lF )lF )lF )lF )lF )lF )lF )lF )lF )lF )lF )lZU6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6x:Nd:Nt:vәtMйtOЅt]LХt]NWЕt]Mеt]O7ЍtLЭtNwНtMнtOЃ=LЊl[M QO4Lc8=AOS4=Cs<@/K2mHa#k#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6R؈-6RH٨FilFilFilFilFilFilFilFilFilFilFilFilFilFilFilFilFilFilFilFilFilZu46Hc#46Hc#46Hc#46Hc#46Hc#46Hc#46Hc#46Hc#46Hc#46Hc#46Hc#46Hc#46Hc#46Hc#46Hc#46Hc#46Hc#46Hc#46Hc#46Hc#46x:Nd:Nt:vәtMйtOЅt]LХt]NWЕt]Mеt]O7ЍtLЭtNwНtMнtOЃ=LЊ*ڳ QO4Lc8=AOS4=Cs<@/K2mHc#k#46Hc#46Hc#46Hc#46Hc#46Hc#46Hc#46؈m46H٨FldFldFldFldFldFldFldFldFldFldFldFldFldFldFldFldFldFldFldFldFlZM 62`# 62`# 62`# 62`# 62`# 62`# 62`# 62`# 62`# 62`# 62`# 62`# 62`# 62`# 62`# 62`# 62`# 62`# 62`# 62`# 6x:Nd:Nt:vәtMйtOЅt]LХt]NWЕt]Mеt]O7ЍtLЭtNwНtMнtOЃ=LЊ*ivQO4Lc8=AOS4=Cs<@/K2m`#k# 62`# 62`# 62`# 62`# 62`# 62`# 62؈ 62٨FYldFYldFYldFYldFYldFYldFYldFYldFYldFYldFYldFYldFYldFYldFYldFYldFYldFYldFYldFYldFYlZm,6b#,6b#,6b#,6b#,6b#,6b#,6b#,6b#,6b#,6b#,6b#,6b#,6b#,6b#,6b#,6b#,6b#,6b#,6b#,6b#,6x:Nd:Nt:vәtMйtOЅt]LХt]NWЕt]Mеt]O7ЍtLЭtNwНtMнtOЃ=LЊ*=[QO4Lc8=AOS4=Cs<@/K2mb#k#,6b#,6b#,6b#,6b#,6b#,6b#,6؈톍,6ȶloZ{gqWk,j헥t]+Z{meWkb^ͼxz /gX9f/^v}[)^颭y_>[Bmk~-5_IVVìm]t-FOu~K]_m۰fQ5l4j{ ֋9~~ő1S{q2#cb9V۞}kc/5^ܐ/kƳsszŕrNyc)RySyR^x)U9)U^ʪWY)[zoyS姤 ϔ>P> }|HX)^kcKY#q8rtj9U:.Uʻ-ny=}s2*/9;HDYה@8HͫW7>;2i^#ͦ]|}z?. d!B5?ԼY^[e)I2ּMۛw|g.n#{edS2ZV+d}7C2?|XGXqh>+Wd%B֐-uh.o5wfxfOhkF岶1Vy^h^UI1c1-߰AW =;?xxFK..goHqGq'_y`1h>HU}1)M[S^֏AGt =I_?Kyn ߜ2iʤ~??KIjq%mM:LG{3gWF<]%һ46Hml>#}qHPHn$#G{T'ߒx]z{{;?=%Ar<6ۭŧO_/^(//cq bR1RL-U*9V̠Mk OΡ-ϋd\1?pSrqsJY>(倫5]VY]ʚq MYɊwWˣ˱4BVe I˛e]EWWWm_ߦ'AW/P|R+_mg֚ӭ/җX2G t"D')t*F/D>>ߩf[GfxF?M^qE6 84?{~2E|mA#6A=hŠ 0GL7nGxO2o{{&69δHOǮ(Ӗ݂:Y% }һc1knE3?'yEB$뤔l&[$5$9+ZOXB_ -tЗ-W-zIB' @hQ^N:_-Bg ޜu{d4DlĨ$'r"YK֓GdTC9M.)N@Ci{څ:4ѣXx `bg}E=K轖 ZԯBWY KWzkBՈ~Lz,tXxG 4m-xU몮K?]h1s$iKo/tӛ/QBgu|Q78qIGe~ ,k_[X}O_tإK"j\ҙ$zo{o;dYG&'d;E*arԓ2Fi8H8HPNt*I:6D?.ZI^5YG֍űDIM? .YϞ"f[;pLM-cY&-ҲLYgiu}"9L˳+~qn(t-f,bm4[:(^hk,xC(ܙn.1Ktu~YuX;;,ao[:2_Cż[:u vC':Q/FXu"5b,5ܲn~^̶3mvWd=6)KcD[@om}.o&nV|d7O18pwCz˄!XsZnDh[(s:Y=>e-l_h=,yBB7&aٸA$lRnYM>aLmN7& quMK3ߓY܊l /aw6J4+;ԥ7Z:sM o'kb9ʬl\+[4$[{$-5B6oF4{ʹy'ݗh~Ia/g>sw{{Vh Ũ7-ݧӄ$"ۖ%-x?~Kh//X:K=CEvgGŊne8'Ḓ⤈y"&։e?kup[LJ\d6~st2f;jK9(GDJK_QѺ҄f?ez]{2c߬啫LhX7t5ֳZ_=Ssli+p:kj#8-JFmc6K:NBzV&༧ГDbU'V[Z:Mh+.rG_s&7ڷUcB-K~B' -F oں'p%sv>sуx$xZvZ =_RNㅞ(tЛ} =NB?:o\:5XCDh.]lqOq9NoMcHuFyxrymuG^+kr2+vDNlv^cSS8%1Dz[#|!W׉ Zi-%|%H uãcNk^'zЫ.oB'5^xD{1e-q$tOyvPopoG+fvdo2}Nm'zmgaPeukwCͳv>m({v2o;Μn5}'¼]cO{yf;m%l&^b7v16{͞i_[mIon}Ȱl8[6{ٍͮ~c&bslvߔv+[jn-x1`aclvyxfo'6;˻ l:]jl6;τ]Xm]b7lOl&{-kn7Ll^}fٗfG6V=fSlv.6fr]elvj6;fٷtm|]d_ٶxpa;CF"_'d#\}GJi 9/R~\Ki fjkk 5UĶ1?U]ľ'Ե/䃁-_wHM$EH$-,CBMih&݃HP@E!WKj%'ԅ\*t!y-Hdyhu c%6 tM I6%%qO_خ\0$"EuMfD^BJZRS6 -5/Ev4%X##GFn%b=JkIޣ]W5w.&;o&ۄCj:wYYݵ[-NLI^cdqϤ ^z]6gRlhl $;vjnHl*Hi\Ϳ[ާ߂'.e-e/$t@II'& l(S$k p>x"9xwQ4dCt֪ =ܪ5bQo#\5JQub{0-rkZUZѻ!ӷViFni1`'B'.[q v<)=dj K"V6G^fau1+Ŋ qJ'XbԹywXaQuCCȎ. <3boCJ_Hb&;o3o``)VhjkF,65bo ~Q5{X_4y"f1صmWE(Ydǝ7,JZgJCYiTR }q0IDm!6cMoӈx_]%͆³(1ߠޝF,9||6^ϣM313k^͛3tΖ'2ewg=ʳįGZ}cՌ5^^]c$iyJmQi즱~49Q*2x^Q( y+Ɠi^ڵ2 +uYff&bd8+S̜D02mS4oafI\_ՌWb_)C3b6KyGi"ϼ4ﭝߤy?Nu6.AdcC5 ltL$ A4nM[33Mh3dq2P7GjxrԠC$o2jaNxp J2ޘwbx*̻ꚥ7JCmɸM!Z,H0]o.*H0(dTqC3۝0jۼϡq;~_U:x"cZA`Hb̾_:aek;vt,h+|݄2t!Az!d4e nr?I$9%d=y|D y|C 2Ԓ5z|0RA#Md?JtM't G~rK'st*F~b@_U0Nߤi;^=XCcYKV6aX2ng, lF(62YMfcXz&6Gd FlMcl=E`KJ:L|!KgK}Y;N`?Fvvt 9s9+Exy ˃y(ǣy{zw7*~#Ln&{y/K8Oޟ[OI'>y2O?a|"I[J[iT!ղ5RMv94ƾu;n~lrwg?8N:NG'gyvqqrxX7og?XOȊdٟ] n9s9Z͝ͼGG# CGB>N~J~OKyO˫y **__y ϕ?+|?)'W!_!?Si|7ENJ߮Sn$%W);J2(QJk1~RLʃʃ)yJ>S)PILY,$e$+KbIU^T^U*ZyY T)`-c)DBZQ)JrAY. S.+vR;IYjE[Ʃqj4^&HD^5IM&)j4YP#u!MQVV'HGHy,qqiZΗrES?է")_]. riR}IH[[bT-V/JEGHKFQZC|G>SzG iVz''BZ%8G;Ho:':'J:';'K9sJ9w>&mvNwNʜy<#\c"gέryyX:qJ |C+|9|Xwc 74Es;vj],-Ѩ=M}L6K˕<-OhOZWe2FmBVjkZmޖhh$cvSSyDy$?A" i xT~P ;P@58 ~ >3x>ʝ{r$ݓkv nnuoo oˆ oKBub#L@?qg4@X/Cˏџfad6i~L}pZ"7ĶF]z^;- ,30"^O'Bb4(d'`?@AI G1p\INZpA&_.FDP;\+S1q9>z~Nw |jpF'p p/\tNGSI  SJ:t`<+A6xefy6]=,"}PB/~<9<_x^?#{`Ra=RG H96G1=R~ҫg̥*g9G߿ "l} 6H&_ _Efd |7>ld/Ju'|;C $Y ϬgV3jxf5<Y ϬFSFxZ#<Ok5‹1 xL<W!~/ȆMҏk5jxM5^S Tk5jxM5v;ـl.Vcs صjZ5v;ՀƮTc7XFz#VވUǪcE Xb5VXU*V'Q$Ƚ""CB14f3 L% G#G#GÐ;;;;;;;;;;;;qkqkqkq+q<8s8s8sqqook8+mmqVjߢJ%{J>_m~k}%؁b'R>W&U_H{ը}1Ѷmm.Aۯ6m+n"stj@JL5Wϼat|7?zz @ zi޼'֘"t ` #ӷ[ 2碟ͻ?&7ϱHdѸ% s؁!2ƻ3"wFNGNd1N>޼}I00, # 00, # 00, -rZ4 -]hBKZ҅.t -]h -{e'eRCK -5RCK -5R-D8d,邧.o4ZO0 8qws͉)'n[I)n=:J*i~v]@W 'bAon $[`H`H` `xVeւW:xJ`=x J;`x6M}ֶB`;| ;.${p^K$v@9|v][8Z mcRȫ9 P&MK<Q 1 Dnʍ F?t`ߕXؽQ_?$BTS9@*N 4~[żU[żU[żPƯb*Ưbj4h: cOA?]&^6({r` xe|0x*꿁%!M|(\}|0 O|C:C:C:Cтbu(Vbe~ A 7h Bqg Dn _ٝAt7 zXāA<~ p+m` `p;;A*a`8F'(Ftqg@<`.(|X "PA3`9xρy"bK`X ^k+`-x2 -o-6( &s |/W| ;=d"Jg!BODh蟈OBē$D< OBē$D< OBē$D< O*7;`x6M}P>'S|6%!5q:#m\K)$֠ s_C,c2,#J' =mFی݇(| q vB»on%o;vANdFCShoϸ]˸]Yd|f4`n~FiAk/)mA(q* DNDSn13wнjE]Hd'p? ĩ`ܠ-a `*Ʃb*ƩFn7gԮFna㦠Hx00sh7R߮in:Q߻*wq!~ߌ+ ExQ-CC>w%Uz8[}'ܠ-@< 7]8^8Nix(},q}۩-!XO4}cw;0 ø]vf;c"<As)X`xσbxVeւW:U?M8FM<1~a z-aҏvKnB 5w:Gt ƁIQ0LLH`n̓y07<s`n̓y07<s`n̓y07<s`n̓y07MՏC00#((ѿb>Fb%w|:&̄;D..""+^]wW9gB\ 5;ERm @J2&4L'$L)=Vzy9/y?c_ bb6`S-5b_#5b_#Mb$Mb$Mbߔ>K,b,Ƿ:d]kumMֵɺ6YצB4p8`}2hLYgd$odw9v:s茿Yvɮ1X]2Ve84p3 iLg84p3 iLg84p3 iLg84p3 i@ d(@ d(LC)*S/R/.Nl>֛KT8 3pޡW/E^ȫ111QOzjSԨF=5QOzjSԨF=5QOzjSԨF=5QOzjSԨlj̦lj̦lj̦lj̦F}T+D"VG^@LNt(;ſYſY)NwSﴎN贎N贎N贎NT+ 'Ƣc.A>7WWw[q[n4\ob nR,r| MzcRoLI17&ƤޘzcR_LI}1/&Ťa3@RϫvKjZy$ Ԩ//C0^xAt.Хzox5GMG}IdEr/묞?㗄񆰱K]9^us0[}n߸O-]>D(Ǟ m>U'kd zOo}r-'ს' />O_d:UO)l |*7G'ˬ,OoUΰGv{dxMV&+ˊbȈȈdBE&Td~U;@tXj{}%'%LеG}MCFS}jʯռ7 ?<&BgwBnmvE ^&Wa/JLPb7Q"PbP]Qb, |cZ& 'ce8pu ;썿gl= _8Z͹jcS{}ppP{}TXB@XAꯏԞS}TP~bKRkuux2\2Z;ū^q}wWE7uºT\jyX9QwO]w/VXEI9*wsLy`ؔ)y*@a#:(~s)9+,wu.6Mu tu={$ RaS]8G(cBNg}{ xNI8{Op9V7ZV4u߉fuVSutttEu?=_0~N%%~13?;?*K*1U^վh-اUllSͪp*ܮBe}Y%W1UL*[lWMDzd&_'>$_~̎-.+=gsyms=;\!;c!{=fzLZmSVU/lf~v+ߧgf_ ZAcږ:e1;cvmvmS!|D}>bۖ羍qK;uN9d7f7ۦwjcjVޯk~.o)ruPnjyZ.ʵrm\-֠-v˫v9z)?VˏAQ4 Wcwh ͻunU{JV9K{eݔB-rcx]7ޮo׍ˑ?#lVʕ$-:kMwsئ#Q}P{ئm:`F=^צӵh],eu.֢`lCڡ[eu՝SԢ;N;t=ԕZtnэsgҭtsi .t]:.ݢ[unSjTKT+ZU~76ߦT|oSm*EjϪjoQYVUޭʻUy*v&0W7UYuZVgL|M5Z|::QQ^,2P2_+eJYdyEWdJYR6::hV}''M4}di:[+e1\UƎ`GwlG9 lPdâj"kYkVbUh ZѠ Z~o5V3h5-VQ=FSɝvSΝr4@ܭZݭnn%wk(-FݵDQw.sΝsŨܽ9wϹ{Wχ9g]_q1w˞qtƻsDT+^|T=qڡOzT41("OT;ͩW2gV;*Î1cro8l]φw_~wy/\iOSi:HugPjZEUyڷqIU\*RhV1.1j iΑr [3*?-]\n'R}'wN6YwZW3DiCV8DTITITI4DIݝIݝNd +]p¤t F^hģT0I|RS)~G7 +v.oӍ+vb(+vq۸m]1wWlvqsGΖ7{4vqx4^~Jwչuw-r!>4Uf$g??:\quL4=߹V85|8F=*V;|nwtGD?&ȿ`Vrx[c"յ ۰D6&]%vѷ's.K%wȹCh[mmKwB83[ɓ:m=Gۮ֣)"/EgtLxT4-MKEkzܚV4hbvmN{MFErΑG9GV:: zq͠ft3h4 fq̠)hM(M&A`Tk5pXqv^rӽq5a7] /O Nϥ=~I ow ~ޫÎsq&zK^JR׺{N"F/5zK^jRB/zK|UU1cqTY]AS> Q| 'ħ0 Ƨ7[ߡ!:nʦg/<ㅰqf6N} >A-o+"ۦvTX9͔=͔=͔=8nV! k‡pEfo`AxZнfEhi kxj k = y_+k/jjzvg ~pi]anzu~>aϽԠ38ƙC dǚ~׿ėe|"/s9˜e 2ֈW65w.܍{0~5x/e`+^A+ڰ юd6  z‹~2q 'u ؋N(X"mC^PkzZU絳ËY|{/{| :\o&|ꭖF4Q-w]IСtZ۠6 jmZ{QX1Cݭhjtd4 5t@IPhft. b9X/s\9>WϕsaQ'y|<5FG7۸ 7܌[D 88zGpt Gpt GD?a Wpu Wpuɔ)?!a5~#x?ϰ?/iG舽?:SAKjǣç:8'$Xtknӭu8 .eX X:fL KՉ/`I"&n&n&n{X wn܃{*I<VG'XM6-NNZg:֙Τu&3iILZg:֘Ƥ5&1iIkLZcS~ $bWTJnT9.vnRYJ7Kfo^Ra8*dMY@5dMY@5dMY@V;Z;$7 My@$7 My@$7 My]r.9G}-u|q%աAGQu,tn:K7MiB7M 4&tӄnMi¾mvwnnwT}|?X099˹+ܕvJEvф]4aMEvф]4aMEvф]4aM3̢9h,3̢9h,3̢9h,3SK0qTp87& sv+2翌_/qJ:%dN Y;i{BI!뤐ϱϙfMӬɎ>ˎrjN!k"LA (eO9Qd(NY'?eO9Yd,5'y8sLNY,A^:&Y&G#u:yd<&9&9&9&95h>Z\k 4&LMMg3&vD{'L3k~2ͬy޵5M5tԌG3M&vGY8,v~Y)HS 3qڹ\Pt.(: M); +M+Ww>"OWLLzB!@>=v]q=V<=UETE]TNfOPPDE֛Cu!NБHz]3 Vx_=Owόs.q.@G9\n7RMv;|;>N 'C΃ß'|   j_c [>o[>ҍXH7b!݈tWwzQXM^jzki ҍXK/b- Zcuauauauauauauauauauauauauauauauauau幇#o1M \M5k z-ZZZ{yFi_3W H6\^E7M%;O.鳱Ύ]B6] KN<,><,><,><,><,><,><,>~Aϫf5qV/9-YmJ9#T_O/'L}\mepj]Zuz$=W>s)ԯEP!~Woem]E-xsxe=t7j9Z3t}03Qbf[h??SߩyJQ{7jA6?K퟈ko OޞvŬة9)9ԣH=؞Hzs<`!@X zJLOH&&8tՋ#Gs #Oќ iODhOD^'n x S#7f`XE Vց `#6-`.tA#z@Kp^ nSN9$.tыC9lН"JWMSi0LezQTta1GWy-ؕ v-=|1c=|< Fyc $F`  {σ `v.H; gp.Kavp{}~x<0< '` y)Q^z $Z1_kϗCryB12 C0C?????>?>?>?>?>?>?>?>?>?>e}_||||;w&b~dej^j*6ƞ-mX/ LJ7n >\ >\ >\???3L>>3L>>1)cICJ |`]b~? }_}_}_}_}_{{{F-qP_ ~5M؛>fI4t9r6)J%[VP &j =Qo11EECxă))m,ͪy \Gcvh\SBϨ7zYo.27L[(7Sb6ZQ)7w yhF'Ƿ[:0 ]-%4t>R%[2r PXo/JӛI94y?b3y}{'+||D(*&H5_2A\x_b5$R7#YcɜԚ;݌%!c )҈OTN ukE)M ŦX.%wܚ) )1{H_B ZBցSPTV1Ξd)]`Պ#GE]>P R$f* EeT@?л?/F?5Nc|LZ3.c|ZesRk?Kz(K\bJ;<-Zn͵6\kϵwZgua=؉1BYCQ5@MAYoC|;;߉xaAR5ee"P61@si|\EO!"תP[HNu&܅SJ!-TȚ#T)ABZB֑k܊f^627rߒZzz{w$;s MS&h CYjXͭIӆ4m'Mt$Mgtae 3\#ȑiᙾmyGӃۑ! ҂Q۴='I޳M9JSR+iP`OW7u8v&KG(WzB h #o3 67&aYD)<պ‰50joب%vV((JKjmanVzAA朷пGґ+ҙ^jM|ҵ%M;ОHNL.hMʵD`favĪgX{ MzɱVouehM-uG/վڢd܋ͥ'S%3*uF@^A%J,\OUm%ѩ 1I`.% BmO,AwjU~ WcE ȝП"4s5r0AUU?ut`IéͪZL7&QG0 ufUDa=]4uɝJWPjg_]l]M酌Q*sԯ闃?k_hG5ߋܴLkBt>+"?:2$næЯ57wJ( k^RƽתZrVmP)f0`v/_\tz5x{R-K~RԒ >mTMSw5wђ-Ӗ `fNZ?f.:/XwJ!i_(݃+dm^+U di$Io“Sq+9_U+7M)&Яmjaw&~-, ,Tz*%s=>g>{*^*J.e8eDVNwL9\>s|" hY$ ),mz:WIܢVuN|/CbBbU,jܯJڪpUammyv4ync%۾\Ƅ #τ憴< g"oGޖo"GfʬwmDGu~*ӝ%99W {BY\\&˝+>RuZm ΝpuGq7V3֚xxsxN!:lXg] J)'iz3KߞSw}(4I-^$a]r tfF>elOG!$F#[FzF#=4dKe&zY(jZ"Mj4SriV-`צF_s6QZi|;;e+lu3ŽYF@/hs7.F[ӅbVI$TKCuhKh+P B;ogVF[o^SS$ 9d>ss1g:g%s6lْl@΅̙tLOi\\*^N/\,jlfQc3,f_intn"ffQNgBɷ2Ҙi5BPg(1fY̽Hs><bF:#is$f3 IF;a~J,,9㈟LDRNr&3;S虷9͙FLw#'gHeqLgN: J[|/m dSL]kYГ_::N)5lDfRnqpum6$NJ.s()&.g'ys*` {؄=l6aM&a`/* "V))C. ,/maZmeXFZ2+[)Y*oĽj"{[㭑Zo=aI_ꕒl6mo4ۼjW.i^<Mb؇Ʉ\ic4O#KKx 1Yl Ma[udRNx{H1ޑ0G`:0],t "\g3A` '9.nӹlt1g3\p&&`=װbGG5ܗcX6r=/iE'5$_S̬_Ubu.2X ]ͧJ l/nװ=7g-ټ'|6Ƥo=^ޛXܯ1Ro ~'2*3󼓑o>կJ~лAاD\ ~e~ RAKk1Kʳ eY+aH#? #_1gH4oVB#hֺ[STy5@P5j<Z<4-'5VO, *3P;{Zٛ||+*eJXK{U߸8+?V)yi}ݒxت{AÛO3:ӭV`6^By]r˫C(ޔICI{q~ ܷzLI%d٧2Vլf}dLW6wr?fֻUrUd xϵmj}eΆ[`I@s6\ߨ#>ԕ)NJ~unz~(#IVǾ1r=Uݐf1sDOSIZ\]՟{Cއ\i<ߘm)(ٗ/SuOd\bgUڸuߟ[:^ŪXFͽu bW>[!IuvQX噲6g2A1 FɜovTe3cSiԿޟ{kw jۧ!{cwpN؞cso\'k7[^Ȭ?~virjkEf' jKWzzٯ|aow&ߗeﶽcȆ~Wκ?~w<ԬX*ZJO/UݓTϚ'1>a?LRwkA[Nٵ\{T*rVe:5uD*gXf,jH|+k!^_* AJ9֐W-sSWw7#{o/knryVVJn}K2ClOYQ {}Z7y- &>u|jK_ tMi6vm%'lUu[ߪ_Ϛ |Gߨgɟ<s щڞ*'($nCOqwdR̬7bOl>?2.!.xf;}9 X/՟wJv7X+>>ʰOO2SS&vO+e_feߕrB޶ i]&4ۺ" Ǭ^سg[ׄ-yE ˬ[++!pqx5,.uGxcxuoxK̺/+8tkT$#adFZEGZ[#"&Ei͌9 =6ri^kaCʊP#GU8D DFE*7\dJyAeF&ETM"Df"#_."HA@Y^uE֩""$Gr:uqWǩarݍMs]n#7CfYBr[vn{rtVCߨnWz==B=vSǹǫ'ݓ(Sj{]=P?VϻWר _rWܡP{{>>&uw;RMquUoOcԛKj;ɝo3 Cw].T߹j[ew*q[6w]mwuR;hHGhLzfmmmǣmm&!CGDi=n=>z9zJW?FegUu=gfLLB@W{&=  1ED.EJ)KiDJSH#")ERDFJ)"ȋ)r))>?Y]]}lgsf&=0L)^v6V@كD#ecemڬahƇ㴃1n714o<Sh-]k,*߭0 !C/bGY:- ]bxZW.:R]bXN\g+ZCt!^ 7v]J)~ˋ__otMmq@7XGuc☮U't_'GcqF7IxSu:L&^0}O7iM/ӬU 0uOtsM-'Ot*XF$S4gp|iX|iYaޭǮ^_.0da C=2e4SǬ@WGq +MFrx_C,6žÝDFlƤ1 a=7Ců& ҄0^G/~ڊ<y<ꏢ/'/'/'їm3,tϢS[Щ2eYV];N];N];N];7wл`f?+hѼˊCt4ΩWROWWROG=sӭ?a&e))3]E]E]ށ. +z;zzzFw}_: KO߇_͂ځځ,ְf`~mga?`a଼6-h 8ڨm P ߵ~z~w[O<aX ֠{Iս[Wt?dtt-(onn7K}„WJ6XG߇]1}̡??*?`: )T>J?b4KcV.$f{Vןg}Uag3/w 뫿Ƚ wZM5?v]`~COA+pZc;a*32nd3-\jn&܌5忻~.[b} *n6\8ɝPw nz`}c}AC ^~/ x]ø|"e> w <ƿʚt56p'l6{ov֟ v.$<şwwX9_.Of_E^`);YRrx GW򕬆Ynk?X_z Sʷ-8 ??ŕh¹o7Qwb/.|ѷ^aG3Qyo?_(ּ3Ώ?s(8wpq55Oܮlǘ07ЗY XPmfp8(NJ!3 !V0 aT"zhbBʄ!5ICGSxGQKuJX1Q H%iAAZPWvzEMb1I]~&u2Ɔi4l$0fjeʌeFEZQeUҷ/++ǒew @}`@*)a2Kskwp^fGl9lAvPlAvPlAv(َ {UGG3n|0cc0cX?I~6×xp"*"DW#GO=*)GO=FS~{Lߣ=){SA=z﹏{){j@fD>550$HA'HP,^LLa?y:[n "ς;X#XY̟<ȳ XX|5 lKJ (fko-˄!% >0t% !F1z򬲘 RV*/ѽ.<pܧ ,T*GQ";CGGP`TrV*TnvJ6(\\y*W0)G~S&2VQ>cvJ1N<'` `&7Wς~N?85@UUdbz1}1} 19@4o HBn R"RHtB\n .&.o(WRx>3X/Y(l0bU#[ &H\77X/Y9Cl!J%7%7"Q` Qr#QrQP4KdeT$爏Bd\$2n\2q1`Pdž7?Bd|q`G-! <pn\S&UP*(ER"f"1aa.%VA)bSX_JkJ1=)ELO)b" J3RXPR*(ELGR*(ELO)b})ER"VA)b5w)ERZ)ELOa;f S~Xaz0=UP~VAaz凍)?j(?LOaS~Hk#?LOa5p,ul0!OU?X?XN E=z}KFMI6KFͨ90jA-: Q[{qX3Rp2j: ~I%P`Pʷ'*ɓPrcNQ].J3|NQ}QE !Өʫ꫸t;vQnY4cV|n?繗<zW'~~W'=O9y &S$!')3p&r8p!3?\Ѐj#oc!?3~ƇggRLYSNAt/^ɽ 2ױH2>d9|688 :8:8:8:8 *P]ʢ,>Eׇ-.P> lPv6tvtp8!aBaa?4-Nr,!8a>S|a*n--T-KIId1*ȥww^xQїO|'/jҟԑ?)979!U*T:9Q'p&q8ͨ.989$9P.~"Kta//P^?b73'I'%wq8t&Ix+'I߉7yYwN'j_tѬ_kz}_}_͏A=`[q*X5;3Tٯ3~oVt?}W|bSx{S"YTe|_TQ| Wy懕N(m?|槕 ʷ%)O"Z6)/R^1 0WbieaaShxV2VkM-ھ2qY;ajix[kNhSsP۴տ9?5d1f9q uƬۏ1. ?F#hh1 c,0f2:ΥX`t`c9*06cl؁c_s8y<{-9?{)3tYc\}{W1n0fczb446QyZi1<9؂X"a#1FGm"Ɣd~=/mu6cBťn[{j[cc-Ƿ؏sBv,0n2u ~5G^'q#a Q~{+6y>t,w3>VGN\;vfڹ j;jUkk7`v[ݵs=Hzּx)j޸PrT;i48!aБq)PyVccccccccccc;tcwʣG'ݶ9 ˎnǵ^TGZuAs3 M8sAfpgS@ǣ2999\]Jz&VgtsE+IeVC.(r\yW55555:55tkõԵܵ ֵ*+{%:h:rK]]y%U 7#nᮂVP;3Т{t{{{{==^(^[Y^]M*+[;{Hߞ!Q wT/oz1{yjR=s' MxrAfpO+tg҃GCSug]^%^^V{^i_1oZ󎄎ʳ&zx{ۼs ˠ+[ۡ;{pG'޳ k7hO^}5> ˺/kMM̀Cy:}+}k|}~ ޷tSt珞NA/^]Fw^]~?iyh:? :?:? :??׿_;____*f6n>RT| Aq)QY?俊+@U:`xr0u ,Sm9yЅeP  l l l =8 = \\\ ܬKI *4~# \p98<*$8&8>(Yle5ۃ󡋂KJ;xS5M1{< {MpXdty ^ ^ ^sm' աP5*}B~ ECnVV>ZB#B{ W &w>rZZ \ϡm˅vv[t]}&t$t6)64'ekcbKb%C;{MЭR%ƺJ["؁1i(ꨜ],Qk"cI{Jō`Qi2?nyK㮸?O;bML^3}(i|T|l|BݍdP^}F|6s ޝrG/ooo_*RKpt *uDuž$X"('$%F&F{912aĔD[bNb^bavIJ OZuՉ^OboVboRbgbO"Sڗ}TtjUjm jsj[iMHN+򩃩#S)ԥ.zސTIMUҜE {7vtuڞ`>cLlٛyz;Nvչ+ҫ[;{ӇG'ݮ k9%wf~#̈́3L.3(Ӝi͌ɌwpMLrLrδ;Ofged:3+3k232[]3]]Ùcәsh抻;s=ӓel5Q5Ϯlg٦lKvDvcӲ3s ٥Uٵ m}ك#%<=EN)gK./{^ހ^cnO瘧''rU=sls\\87効!^F%M4 _nܭcPJ)9^3ܹ/זmܚ---˭p/@nun]ncUcr[r]Ws;s{<rsrGs'rݹ%?٠4s jކpC:*!Gnzɻ44axqOsFI Sf4ꝷΗ԰{mXҫxV +4t65lunj ۰@cm8vt/k8nk8pzEhI7|e^7+VvYGŕz$M%ͷG9?G'-E'gzs }ɯ"]\059ݝߑ#yJ]u<)5  ; ByP, ) +  S m9y8kaVV6ve)*ݲpۗ+..n[_4~Ś- ҜA%o%\^l-)́b{q~qQqI%{fq1Io[t\vrbJvriO)^/4{gsy|f| 1MbȺ]rjd5_I$_I5Ven$$dd%!$k+&a%y>#eQ~{.uss{er ,j[/x/u+WVԻ_EÊF)_TpiєklXV4hVJhF~j\~ݼhUѺE[v_X@cEEg.=֮OjWE͊u͢hh)^D\-?Z}>:+:?Z]]]]=====clՌ5}RAIXau,~PGX؀ؠ؈ظش،؜؂آزJ؆c[bcbcĎNNUxxF@<7/7մem<WX #> 7>8>Lӑ1Ú^nn.ؚ|q -<5-^w ={MtGJ_PnnFk\~MnR˩5W,TU?nnnI-Rt4h6y*X?;wk'6_~ ~Ch͐i.k:G AK᛺KO|x?^S^8XX2i}1p =c|7w{KysxmEb \超? -xZz`g[$pN#cFa2bb"/f 2Xeũ . yA=SS U3nnp9wnWd-7 w[3+Ҝׅ= cU3Sއ"=q# rdG8t>7$kBoC7fx;}LoaC'A}:mA[ŮyBmZ_=RW Dۘ^Ӌ2nP=uSCvLw`yjcJZ ʿ[jeDrUmjMNuj0[Vz ו֏>áAo"Ob͖ӻ}Skʉ~:̜OЛLO_M (D;uHORNj=I;˩|>662V}g9DZ}f'X06l>a|gOR&T 6XVS\B[ik K"ŮދDžŴ 5d,:iNx1gNx1Z3XB5//˴b/ u' ])X)__ gӇV2Vx3yבάCH :F: =͆3< < |'sR09(bw\9;hNG`ϱx>)g75OzG `tVbC 4Zt+XIJ>Vbldx[u+PjSI:\H(lhۄhۄYGBy%_6jΟ3NH]5Eu"#Ԯ->*#h1vP}=fpCX(mXϧNJ&OŎXr^G"&ZF=-:uqt e d:KՏimΆ3[2C6˸#K]- А+u5 |m0{#.X֯ϞhK;X.~svg}1KéRn)*y:z2gd>̜'2k*^ Tp _QOD}Y{}ì}'zه"}'BL%TcU]=b漇 GޒemXꮥ/;ଆWعϹ}sBssHOJ{IYXݒSLi=%AԀN ɫɑQBCC~]9VRw%ٯh>+2:"VN%=ѱk6h |Pvyw;*}|l* {7ƛùk?6~:Iaq%Fu ~c> \F޾s9a^5N=`89[bwOa>>~9lh&]de_NkEJLZro Nvݗ9W[Г͹z8q[sn 7`osh{deg/_RiBUoR){n,V[l.'ᔙѹ+9àkL3T}˅8~-k3{n5/+5{%>,O zS߻B"cpf<8'2Λ -ހS6jik%n0Vݥb`ş3>kdb#Rw5FXv`grf~}CWS| b9һiس {1i3j-%{_"w33>;L;&Xnnѧ{1KM5iMo#i>li864O 4ARnױp,a,r,w ch[tDj=a ,qAr~s->g8hğlw'}N|!ie8XpZ{;6v1Qcč9O}ZPsYPwЮB-evc2}|Nv2GRٚp6b_<2.#cs/x3Aɗr8 \MFүGG5[Exȁav-;]yWY.T %JK&ߛ|'$z[!ŠHg]WBWԜ{8IF%9RY\a&y7ՐXL䐎N8zl'9o><5v8&H/R߳4ؒS%E^z!=Udka,|,w'bXZ\K\Bμj$?dEӻYN1VC3l{qOK+GVk^y7r;gva&[͝'Z3`gi=̐_McB%O*'lάhì\kaP\[sSځOo .Av7iWMp.p/ן[;!pGrje<ȬYA>xc}deFٌ ٲo4//wzF ŝ.Lz>"݊nVn;yF F#snV(pz1.&kn{ im o8˪J]OU%9y+:Fg5OKQN>277Hݬcfd3o7>@]Ybe~߂0[` 9Ӝin_ܰ`sφsdVؽ5w`{9i,4>._i%*bim+܁+T1~M_,TwݮT \29*,t]zPoXU(Y3:R(/hP_`Z| KppF?ʭ`j)r>YGL. X_evN+8+v^Neba6Du5^ދ?Ƨ~Nȳ 0UCZ_l{^K] gnJblZ zg-/k~.qLY^Ef 2۹X8k(߉MS?uΨ٦7~.oػ˗G嫢9۠5P@wNI^{Tu7[pkM&YSY|ZjXM6k:h[sEetUSUD*ΩWKM]+oG=pg]yɼĝ(@8״w&5uyKȜz2Y~;RYMdy |,{dUrC,6KGRv uzZc,ܐ{ĺjkV6vϬ>V?k5za=f~/^ WW[oX_Vk>cSu:o}eU1pJST uQG@#OݣXݯ#j5V=Ʃ'x5Qgԯd5UTjZ֫&YU|7HQӞ4yzaz|0鿐hGTuBږzjZ&Ug]gCp5J2AMҭ?fL-U+hڦv :9uѶtƟg7؅WvUzw};Gأq?4M {ָ@-h^kohze-YȽ_fM +/,yMS紻В9-iQPoPma<9_řCt9 <6sB̩gʜY""sMM۾ܛy0HSs-u#YyY tJ¬ߣ\4CV׬Yw}pEePЬWYW59kZ֌9Y mY2k-eC֖Ugڟur4$tljف\J~vivKJ8w3wvك]SFf]eJtt̞GY8{you)[w|>cg)~M.{=#3Qȳ;*!1J I߫ dj? OFfVg``wwWQJ'z^ 6#y=vޗeϓ /8J3SEU*{̾,U{/Uoc9K {lվ* T푔{d>*IzP>f Br%f|>8˂K+\\<<TYp5g7Xdxc[gw_x`xpxXxdxLx)Nx^xaU}_Yo$o*Uy۹`UwuIH.VUUh&7 2;s3ɽοtu%*[e|r/.*5* XT%yd>]c"#kN?;TdEB:zFfR^oV#"Hg^1DDKa>B.V82GFUAY IW֟^W#dEG"K#+"k"e*_9cϑMm[G`\%999Xˮ^f-ĢܺVV'uNP+i+րZd^Xk(_k;⯪o59A,~4| I(*6_jOu8{͹2rs ď2Ms[mn\tv&<`H'ᜄse83X:K,W]W`^E]G&.l#? ip󴀧sX2P8x:vQ`߇C,l% ƶ48ip1z>GG>7_AbQ=DII#8<7Mi09h xλȼ >?8dƁ{{ 3QQقHYs{v1tC`cߍ}߇REE55y=o?vkg!Ϝt%~L~ ~ߌlΖ0Ɇt0x0O__ Z2{=HGr=?y`?*.Mҋ;[[ۃ#g|xފ^2KY 6}ׂRY0UUɎss D'Mt&&쟇;;{6N2qrH!?C tq1fSw,ubI}p}1y57X6knn@qWЉϬ$$&_vөNadtBO'l36e9>܊4⼻w "Cv;s}T,51^C5$^|;h^ \#=!3ٕؕ|m_h+9hgh2'[43;#f83X+\+*^^ A!b6zZPn f&8g*x*>:љ'̴;wًGOÞˈ1">Җk":X E8/ gr[p hAxS<)+WOD~" 'BUBLNmٌ֩ͨ;=#xv:NFa"c"7u]ֵF&aC`V՚L2.eyh}d.%ڻ.{y7PdG1!9`Md!ghˣ-wzF_ .!OtL ߁0f?H>bCا4m]Ⰷg5R.GO5TC,BصG0uC+JY6b2#G`vjd#@ t>A[迀 2w zƀ"OMa;yuֺ oXCN7G֏`k~c]ka;7v򮼫s5QȮc׳inev+,cSQZn,vjOhU{ϒ ̑/9y/ŝ_c )7뵼_,BBݦpNycM _k Gh;{.SԳbS4RoX䍛_/c] ?o,{^U{'& RӀ)"C)E>iЈ44SJ) P RJ)iJ)P#C!bd=o7܄ЦvLYw}{.]6f=8Gʥ-Hh^g/@(+cxՈ/}A_c H`K}C5q !mh;k3qjY+ez fCs6fqn"\H/zǩqK}ԻQZKe*S[4EfzL)zTt?yT+Xbջ;`#^f!~@sL-xwר`?-`gbCH9ttw]/{@S$0m)O#vЈ͖s[qѪt/ g΀FgG粍E&K>ˉZڞn@6@H"K֡EDw0ڏDSGfd`RiExI|`|bOOWgPlg{//I7M\7ƷS@qoTcl'OߎSY ':5Sn ȋϧzNVq"DDJD`|*DDg.%8+v!141"1:_:JLNLMTÉd4rEK4VJ 87dh FJ2ȐĒXI1k(]>g~b-QĆHD]bKbGb,'Gh].?qƹ)2%$snSiG3M󉋾{~<| YF.]{đ#LDC=~$Dܽ@@Lvur9JE?,PL_J1/ĸ8";\+#D_C#{/Rj^d_R9ᯊ#,;P.1kBGv[n|Ҕ?ퟍHj)ˊ%%~i<1.+g%du2#i/U/| k`WKeY鞓>Q݉Yc& 6"%¬YcIkʳdMʪΚ5'k~eYt]&k=D홵9k{*kg}YoQzJF{iz&k:O ̱sz pi rcfNce92Hbj=&bWq.Ŵ7l@0ҿy S@ѩy%̴+OQ {K̄*k Dpցz5F]Qn%ܣ 2B^=<"9D\!1h)89^5^UHJXgi8qL^Η2y#>Ո4˵q۰Y͔n}?@rlK򄮟){.P'Xq|u_/C_`[Ǣss3|?"V794/_Z };kP7?4Zy99rGBOZSQ#Mܻm=EZPj'X!6:4rA&̓1Y7PSY]%BUȥeѺﳜX`7R26e 1,EI 2k(-jz$nǢO#TQ='`\+1ǠK0+f:0bQӣ /A h?[6%v&~d?@WW5&IS 340`I\J uhءa!OpHpT;q 1պ_ǗtJm'ro99(!]c,]&}߻?Ҥx V^6o̱r2Ffa}=6hΡ5\E^p{&ihYI$ۖ^$8F$:ϒdɞW=E2G'i<8O΋HrJV3=^8Yjez\8j n^qez,9]aqO ,[Fd6Z zj]UhgmvB\UW]k2} [WɅWXIZ&ke,JKN{jǖKbÕְzM:5 ߒ2F$j<^$i&GV򨾞'ɳU$'ܰ=i@ιMj4~z4KBri Υr21&ȥ5`.9S siKzȝ"ʥ].՛rgrH\c.r)yO͹T5]/z%=n;.zvݩvkd,ϥuS.}rɥ~K\ZDyǨyQ}Ubyɣ5MezdOYѺ&4y5_y*&6yjsΛ i& hG g.h>^i$h&~g5^f,2#1O10 /^%]O.-/-o,+uO+*U"^TW8}#zk/qC[FhăF|gkFe #Vb#F|a _E<\ķEZ?x`g7׉x_xh_5Ѐxoxhxh۷M!>? hweh ŀx^h xXh xU?xR߄_ }"B,MvڋZPZMįA<ėA{1z,ho%HGO /kxOxxx __h&;eϿ/eɮ~/;ec_.}#nvʰ̳'a?X4QXa+fōFʵ ʷ>j(wFúHZO[Oy06#nqſbܸկ4>On3k'/mƝc1o/P-K4v&FГ`@u00c J ** $!G`)A-*u6l%h h$KpQ:׸ :%p-a_R$A>A7_.t~  9(KPB0Q Ln5,9 ,#XA`nʸo&خ+}3w&GacW$pMۢrN2d'nJ䣝4eWhˣZ.w Eۛ^+W+A%{]eϰgs%r{`[.{>hۧ&}Ѿĝlt "g30c(;eNSLwf[{3Y,:uF48^s~uN8kawnr ~@w;uK܉n;ŝn;˝ww=`&tw%[:}I{uHy(y^70S5br*: ZtT_?'7Sˠ{o= ~po7I[%Nx|$=tFi|/0@7+ոA!DMR?z݋3mF~{;8YoŽCZJr+4EHSFtB?AA}[[O3vCI#%}҈CvHd 9`h!53ωJq)R͠iT|6񧂿ݜ;B@7>t#~_>伀Z /J $*B=0} S=β|@N3hIsp2$.cRfH ue>~7 Ԯ7P)#3Bps~r-]~ )a!NYtA9}# 0@aĎ[:[$ 7t>nj tp.\2OD+? (|a zd-v ׃>䟠szd447Cϻ?;mpv??ƿn?ѿןW# Q |o1'QC VyfOMsMifmV|&,iKuzeJ 3PiP8n2e|4Z|8lsxJ+/{f]+]y ;/ρǝ<*-#"ލ7B_KЇ}p*}9@n[Nyϟ"}.N1. n )qeO>?}tb16]98rhL1y[(4PmG3gaN'j !o4bVJZ-28LPK;q]xn&rUWSjRZ=fl UPTsշW7,V=S {n-]u?70nk-d^U"2˴'L t^D*bikŵ^}TppETj#\W ;jo97.zO)/EM*hYn4 Ytz^@uYHu%ou7zg $b 7FccQnLI *{Y@$s=aZ<-LߛF! Tڮ4&10Hunu r#.d/Rkܣ&v+dɚRaD:iK5}FljԧS?SFj|lVo0捲Z %rk`Y[.k:h[&um|flw{v=lGcev]?ݞiR^e7VnCQ}>k_/9v|';]N/ 7:C(gSLtʝ)4ڙq;2gGYl68NJvQIsZ|vRF]湝ܮn.pܡvǹIw;խrgX\w]t׺Zu{#_wǚO=q&*ybs|ZŽf}һu;|[ "o7֬kfk|-*Hre]|ks^]`hʛ_3 ߂03!~b>| S-0 )}@J?x<~<k gYK_x̧_/޳?n$0H e||"mгy||qA!g@z|AC`“3 c `|O‚yx<0w |_;>cR^g@!|3QVdN2zaf` 1#/SQ<h?@0g|0 z) "A l&,߇0vb> "`^öqMݨzO"u>P_T[̯#2 (+XC(AR>~>^ _wk^T3hEyu#_di-O8ܨY3wI!yd[4FP i5QJ!s9JYem%$:w? _1~ K30Ȱg+zs?J`1R4!Wmؿ 0ƴ@hSljnߎ4ƌK[XNhMHHEj.jOkҫ-+_tw_ZvDߓ5'G>EqWRH$we3^Q~TWLZ83:vZi$,-jqnQ7_|"\~5Z zRXR4`uÒޏ~wHÝi/~ZjuiץV_j-/m׭V1oW6zwy޿FzW:&V:.V:tbXXdaJ'+XcQszg5;/}ԋ嗥I}BݬOV5XQV[6lzn%-}|gm:4PKͦBN kww^%y?noShRDkqjE5[W1hBjc(r ԣ{Br-k|5 AuCM73fZg3Njs>b%A_q=xK-_3|TGPu3W!vf+c]>v\"u=:b[BQv[e^%F;l;B-s.HSqF-V俐xWo4wa uGGʐߋr(< U39}yMϮΓr0ژiCiciifi0~3m>fNislw7|X髣6y{ w8U g6\8KJDmp-]Dq;#lj:49睋yp=7f݈ED sGCPLPꖹn%tJ985Cu-ghWh~N:::NpxkBMN]{%w li="9-Sn2.5΅O蓠j(P- "XG?- oO{ݙ8(r"* _ vVvW mӝA}SOz"kmarvSZFd,A ;Z|412ElFP6Osm,,#+ִmf 3NPȾ[;g4"#g͈SΑ9MACQQs/D;&o0-w/Ŗ ;.9Evq~d|}h0!CMIE,NT0_7Epyȗ} i6ʦN;S]nB,XK=](8#>9UϼQCo[9e0oa Y8>={u,r p,8G m~pLFb| WͲ)~قnA㭱?WcbaN?-oe76eZ| ;佶a#w7 {x?p2ހ[Л!؄X]:v]1r{skRB6vdr⁜f$rvw6rǁ"8Э`- طc+= 'y,[j^ ]3ӽ*DD>H "$++"AXQQ DD$ ABrH@ A!"DDGC@DD}wEV1ˏ{UuիW^OV Qֱd2k~0SyL1/NMOoA6B pεmeG%¼SerERxŧw{en\jo=[ :"v#獲(V[6G8^phptOQLOmѹ4[kaZ-%nYZ$ Jk٧E ]Ɣ\V⊻@W,imouA9 uʳJ$1OBX5$I~PPK)߉ep.[)Y/YEkj֋ QOW|m5w H*ҷʙQ)j^w o|tWOP>/+jeůIz}P6$ߴF^mM^_ˑvV_oҷ;]> 嫐BN5hȈhik42vۗhtzѝ?f2n7Qvm "ЄQ1ޘ owfx;0#S4owˉ܉)XnOTte?a,w1xƔ+o4/,dp'* 176c ܼzfۤ4<Εgwwѯc?ٍwv2o}b(5)GZsWv1{{Gq_wE2֑X^ܱI ߋ;Ky{wygiytO2 w9ҹo'I[Hs!o/%s#;(?RޞOsG;xgWN#V,^)d}0)xUիLp !~uc2wz)]UWEJ9uIjr߮ f.(;{'e(1tNҒVgG;3 =P'o6w]`uu# .Õ+OVλ˱s޾Y޹YƔ>OtǗ13[AM;qހht3hЮ{JM)؛gI'h>JvJPhh5m7' _N0 ,sF#ﲴZLSrx^;dVc'K{i睒K{e+X5#/3f*vwOZOl܁cR;NF]BKe~>i<+U6nHsygBfyb{es v6<;H)oVl%r=NuXvl66JM9jWGOoDDz5<=Ow:BOw>={WOjtzz =]§.kB}ٝ⏤#ɮte";{n0:I+^Y2uU[*KZnLmHj2f5ԺӺSQXZQ;E55]徭M<ᾑ)w3T\+\SsS}K\djЗRڻQf6ٝG""r*W'\>_qI8:8;3;w/>>$)>'*J^ hK #}joMfRg9m81&/M^BɖAI^mJ@/=QRJ|5Y,/ 7ID7#$@U* 9t!mxe` PZg'݉~¹71 "jwA?h> _OO6'O1O7knQ̽.h:#yYҮMlrWU4Zr!w[T8I3X**HU`,uS;nUuR}RwqjRgBj艩IO UK(575ԫH-MB)S#e&ΥrкPաMYm6വgV }fu:w:JJAz)DȺn  @g yКcK~o-Q1k&+ACY*/Tv{2l`w_g_|}p7&훁oomj/B2[++}]ӣMOUF˪0aCU7qhBg2moYY sց^ll*||lg]qv8;7;WwMpKUvuen nEs΋ww۽ v; c"w 77eT;H]^#w?EuwXt͑U-R!˅]<ڈžᾺ:Wj.iIߎKBI lʴ<*Z\]r]8'-QOիa#h/-l!砊g-rsR 0⛫$𓮇oARjz+(OgydyYdg)e!-N eY^Gx rDqDqDq8Bݠ{{*a0xV7' AJ"Çf^߁YُyV>z0`N.9^~nb|j\. z9z9 O=g>xIW@0g$`>`>`>`>`}}}}0}}}}}"zE8_ye]].]]zpO_Vow׿Eܿ)~z_'m@JL~~<4ī7O Xʯ3WMQ.‡aG2aK`5(j~Q7D>0G'OX|.9%xxs&ey8^ڙڕ;F1.c)),)F=[>͢Cxx^lC}ҫ־} };+ yw-G |{#~2mH 禎Jlc-TaA;UZKWjxT{̛Oۗ+GʖU Ex7 14--̼iXE̳sT'y8 A< $aCPzSffUoxf&b_^kCJL9;CHiG{2=YG{*>WOOU3Uҡ_@QA'dUHtMiж q*+{]*ETS}IZݴCmllT1heoNϫ3?R3h]/v_t(ȞȖYqS[Q~'q-ߠMQ)q~9~!))uy_ⱢߎGрy?m)yr;9pnrEUS1|#_~ɋoT&;{з\&/h!y^~1T̡7?RΝI"3%s9"A~go/?E)&WGzHbjmzW0+y_4+SM|y r$V޽ǖ6芊_MT9ilF-6~ .1%\=/<(_x8`DŽ#x0=<+ ޯFY;û»#JH(3H=/4@m#qY%6o)EzD#}%?"2S ψ̎=?"+&.[k azaBu#цD3Umd]Csk['.&tqt$y!mg?1:%: 9>:qGVMѭy;PXPzW,cg>(kրvXi{( <Nzu1x&6bcKW K+{y yPb;cbb*?!flg4t7w=@o?OLOψL/,du3[~o =QR ŀ&Ъ2^Ott}D7=}j wa~ 1#x0'1/:` 넑x/^b-`=``kbGgbW/q03ff-|L>̦f @k?lgv4Jaww}~A~`8`@I 1#x 0|\`.1WV3|܀p3``m7C0=N^Aq%6';1,RNHɾ'3  T l|_eg_:J1%`/`c@pJO)tJhũ&~ͫ%!8!-Փa?> 05 02qfTg@WTOSp"N3}"ayc^O-,K"=/6> aG5]}V*Vi: [I7Z- tzvYpk5 x$k:`5z k Ukk3@mn~됵VB!;дY1'=>wAn)'Pt8c!MK@=]ta_?{4`=pĞa.س {;Ï؇}t'/ҦZ@[@@gwݕ x 0Χ&9ytӫkӛ[;|XKؗ>:@Ooul;g:"͎HU9K$2iꅌ ;\ikʣ_ml?>VC2N4S ~wwzE"s98c;|z8~g@O,<7y/u^oYXlp6;@ QޡhCW9 !7욮 os/6ƺfn:eTwۀn춏4v;E%nYBM[÷bcaia3e|~=\/d=> ywWr"ߧ]}\+iCORW3tsBĜN9&G;>ۜ4`2hP9Ưo \4;Hm(=+tA'˙dlDI_OAr|_9|5ݣ7g;R瞠<r(a04!&S&&ڜ9@Ӎ9I?Bz`c9lV&B3ƺ,,rƑs{IM쥬|>&ȧZKݍO&7?dKm–'mx@brz_AaГ泏έ7G+gJfo@9q]^?.b0 N,7 v"C93-ķ]JșR:2"?Eb|WH%}5O39/֯?b#^I?E` A"m&{5c"9ϙzy*XrG/ ](s䘂􋂇ӼLčkLCZ<[kڂ/7/'(> &hIM0xĆnezlHJ_p.d%濆I߅|ѴB)%I =/%1~ <8Bz0C,#GNv7!@>q}%wO FCL jeARx%-VqPvbK\}Ai7 c\.tp!'HKtrRM#72΍B6bx.hf0w!9dǑ3qGd?D1?%-M4<^D!b77ic2R-ڣ,+l$t'Lz%IB\җyY,KF߻bS/ NHCĿb?c|vs5'#3%9EEo }lx&mH{֛v8!8#ݍ8Q7\z9!4&g cٿ%#)1 '8SMPSHܖ2L )? Fz<g-@_70w@,m=o\p}+9~B˖ѤYy^/̀̏ߢ J̤KJm-)^+twؕs{?e-ae:x!Sw碬aÃB:^ؽB"-e0kwA~Еϲ2ͨinܞ&CѴy(7J4-;7[$kgY' ;辐IhGb Z K;#6YZx1\4I 2fd}!Yq@rJWRs.t4mOkȏG່$H-; 2Os934{Iw#?M uUgegz@?So_j us`?m?f:/x6"*bY#]Wfs'# ≔Pvb(ig\Fܚ)g2=ԖoH/'sDž( vA{8 #gb,}} r38= 6Ls PP+ rӿ~Hm3зBNR}KC [疸OwC0!w&3YC_@?<GGK3JՖYyX2y* yۮ/1ZԎշe,<x-?]Qwun ; áp8lBa'; -mÝ%pp9ox0`(`ox4`,``rx*x3+~Yx%5uፀ->-`/OBR=`Yeޛ>>>s189p̌d\c\cȌ!Ǹq1.9^29^9dFq=2>t]]^k zqqsAqiEqpڣJ@*AA[p3 셭q:zNŝ;?s(BKqW⮃nxfYqMf/l͎;͋Oeĝ-eV ց}_~ox+ooXߓUC蚉x6^އ4)tyAG8“ӠHCx4qMl Bw&hx6 \xi RVMoG9L뽰^qyl<^|o(;WTmQ_5V) L+ہЭFU'J N0?hVl\NHX2/`:|#PPZ0;7+6'a#<67+aSB5[pɧlclvP ;a/%'K8pÓ^xs8JNQoazp vKw/_  'dp 3X~N6]OKK ,-©UxKA@p*y^h@E TQm>j@C#cqg'@>|} xKxuyv@|l2Z(±9AżX #*Wj50z}1v#E xKrj`"؟ _E8CXTˤ0!x}@ӂ@>BdH̊K 󃫃kA%`eps`]p{pg)l vN//oC&4# p2BKBfVFCT* 6CBաm]ݡ}a(Ph04Ih$veM|A'o&hA@| \blb)#1wfme94vv$=䥕L &ޛЂĔ q췿%ls*F+38a!l' ,t<--JHE'ˋkwj5-Y_#Ż޾YgWxW2d)ٌ[~IvyxqtwxaϊP1X[0[[>ׅH.ceJDv >ecCVrsBVNqiGw~D}"b7wl;MuQxb AV[ZHȒ JY }Tqn.U(mù|vLsn529kJDv8_Wߦ]χXCݲwq`Ȏ݊[}bޯ}V9Q4U(qل8XW~s2fǻe[\ qل=>^rٔ]2.]``>qcledjׅgKL7ؿ$޹k|~5ݑ^.&n[-s=򸖾_0$.Ƨ8.bh?_pY8]Dk>Q~N&ngQ ;!$;ivSDqy7-L;+<}%Nyijm=̜?>[؟ŖSq$n8= H׋߉bJ"\ޮs \oWi^8}I߲OO3l}߲YwN;LbfKmvOg*iOuϻ>q'=ɚdg7=ׅwB?5vZ׿;tA|%q~Z( {$U,v{e:xt'}L2w^I{֠zPud N#y5_G0+jY$7JY#ɝr]J*jZUZUR[vը:zTW5uSa=Ozի:]+t znֽ/=nbL6fYbV`ۧs}u3 9s"g;kb̩r:۝Fg9uz>PߙvN,⅁Nb\gh4':rIw K\3,g  ' r%Q67=,o@N)f8Ke(JBg)Gn-vS ThwmK g5ZL.aNnyPl{٧rSbU>agQ.Fk#>"ĞK h)b8y@# Dt㒌m* e9vVqyW;kmpJq?JpOJrgSlqj[:@;]hSӀ_t$rvSɀ=Nڣ^g6P+bg>g׾)8Ilƽ*pENK),B2NT vW-Rq.qk|.qfg יRĴO^'^}Q+ Js;9vm\;A.P\.T݇t]43*MΔ" ڹOV's;zuDB>zߣl3n}6ngj#3R拑ŭ .B] #{۽ v#]n Vfӓ]ks.{-|\\#Y-71a Gy~mNֹ)y\EJ'lZk/w|i)NAEX*nzMl܎ h?ZĪG\]4zc7"P1~5q'ȁ }YPir0Gt*T}Wȁ">8Y٣@ިB:<Y}n/ؗ8fٽv;nXRJQr5n.-}>얊m;%*v #ٞo#=NKg0oX'C2oⲳYĘT2F,zI ,ytV\|mI,::ΧSIǤO r,tn}Wx#}UO|F!ch"A+  ߉HYj`xL+ XLoyRW!͏O`md ˮՄFXs⇴Ƣ2#EstK6VxfD:d*Sƽ~*1TS]K)mT}R܆䛙&u~%OʏN[1h5z~7F(ϰ;t,>ߚϫbLy%`Y5-t2P{ _c5o͜ G+S˘JV:Y. bN>qUe+}ԪtZOofeN4UCo&uK'Jxc̯(5//eC9ew>kJO(Կ,S6)d4脶BR`=qZg<>s\X Υ@W"fO)V3FO-:jԫ ^v6zs~G#I:CHX]u'*XIRe3IBO;T+0,[v?Sç ܾ0ΥTOF47rXtXPj#UQ'םK91g 6o(PAN(v2>Au5븎:کRװ[ *۟{8wQ)a9/}螎UglzjSrz^҈#3JNS;d7I.^Xb_f9a8{q2;z4w1&'D|/R_ovCˇ(_akR_𞌠4ቍ&6NB5a3CnFk/_h!z[.q&0Pk5YOw!D8QL=N9nNcMHcji-)ζ{8ҎX E;d", dS4}G:p8lH ZS]pU7lo K)\xς^!H!!rB }"TRkj }7#wԽ _M'Ĺ>K?XHܜe/}y=֧‚r5hXTȳ_!9,GMKH xh:o(ӯzDnGKA=(jJT4"勔kWHRPVMj=k5Z@mOyF'Q@]#eϣsQ:^yu^Zw}1DyX<4Ne` "3~UUk͜d.jEjkP3=Eqs8'Ő#&[ʀ 92E. bT.92Okd Ke5V(&;!yD'd䀼(/krT)bOQ[? ;+d]$=% -AТbr՞\"^kJ.0gy29X3Y4"֎r_θPs:od\>Eq57&νs/7)b.I1羌K▶I_4~!cV͹J_ɥg_gJ+S. njхV["rE 8F.:I_LW۪1g>cd zm1f&)n?"VqGJw~oh7ƸMԸ91yq{X%f)9V&} ʹ30ǢZt5~x![@R 5P81Lg@j:.}w/w;퍛&k?{6FwSS{%; /Ɂ_G |"6EOև}pZ8+p^ᏇW ?. {Ug$4\MMgS_Rkw|a,՟ oǻ;EjxWY\O__v A]b}O]iJo# Soe:7v xw?>i٬bs Q\@5{anP@>:caExt_f(ܨ3^kc!2J ~E:~dzd^:WG^k4]ŕz<Mf{Sw1xS?sxg|ӹ]_ cf2~3 l|F11fI$/e#P;_{oziZp7fzK:t^‡0#?TI3❘O)_F J) g;^l_'}#* #QWݔ]Y"UVN?&UdFV!PFRAiEBL:#:Ku(7A=6ʏܕ,F}n\\4$+v-駵-cow`w4"py2)D+nu >gD-.F=An8a}xx;NrvdcZ4 tLӗ wp$EѼ6o^ODZxWc?%u둾+fP+h?|M2#{#(zg`hX.v9)t^-ׂ/eRn[n)]msᘋ,lYJqh\|\G>>kaŹkL\&LYr̝Z*KE4֊Cr8r1XF}s@ R*\WGf)% (3߱E1{he,_H#Uwuz&VH[^YJ~|YF5<~#i/gXsM)wrc\#tPy9|s5!usY9ۜ8oS^ja }<_n'F`^w,Hޕ֞.w:t^QwwQ$6RQq7?ٟAJ=ſq#lَ#d7CzV럅HJMJ3ֱ7]@然"r3Mߢ_U8_AFШڌǢu{ u`1 dXXS򊚡lUW7uX/֫tnW_61&լʬ5M)cWi6-vSgWNĸCc/bW'`vס7!H87FuzԍE$R9Hq+mG E};L zf8f25f!3MC4U/kqCtJ x7kG54fC#]FH/VCd*t.zu=UؤM¬(}LP;L 3+wxrUGWz iu*S@vE׫TK7 2RԳV!f#j9gqin7tAN/& #]+=<9@7RyHku슺rR 5CvAZk0BJ ,*`NmDk[ ݀Fq`vBNS CU2u)?¸RB@LqשΌVc%qyҩVAOeS]Jh62)0,N3dYu7 L&ʄfN|.+;1s7szI"jSf|#d&>FgLEb? n "DVQҪ_e$thfSOOd'A OQvqttNeј!هs}|Vvۜ,kfWs`IuJvF QH}ugyI@K/ԠC_ ÿVK:"MY>+Ғ'= x.ןW}()yHݕ^Eh)"7uho5 Ÿy !BE8*Ή2#2&eX@PTډ u[H^Wc?Oz܄>]tmSfRlkomjfg]5`].]F9dɠ5d [Fu(ꄄQu귶zn0NYgDQ JV:(}V]Q7%=Eɐ4sQ$ jm3\g͋ s JsΊ 7Udm0]gF9I:vVA&HrM15V>h5!ATbSl倖r$̜r٠y\J6 B+!:Hl3̲b,bars13ɘ%u\6mz\Ӄ:HcuYS9vxrM51ufNi3]o8spCyT\v̀䨚M6m 8bوCkEP8VCr GϡomOls<Ale5y퇂jhr> y;iWTǐ5RIl1>:IgH=yNo8|38V$~ygLk9a,hdKAK?fyY֯h2f^(}Q:Du\Y_1Y4R?9Y0퐪VsA)*hj(y4C}ߎXs;_V64 ܒԒjꥮr:|עʀZ")Ss.ir~9,rFgpw8"wfžiJ/ CLr-Bh1^O<-f +1(,PbYA+/)S%XQ괺3ucދ3S;}-do}d}a|Q!>xS1#]ץ/+H0ҘS!ݮ0]-bԪ_@gݙx '*"* "i @DE$A1hB! 5h(!D1svgn9 ]Ꞟ*2~Hv|Ee*Lk9|Z̫!?2[ɫ-Tm%/·:wښcgoeXcayV32^[Eӗ _Wh&TV_kکvZN)zbc6Mֹj PPV?vx+j՗]gDTKM_"{7X5ʎj6-i*Ul5J(kubj\ex?|qܔ ΪU7WstbJ'~f BC%2Շ'O[Znԣ$5O=XzDZGe |p^ӗJzDɈg@殛iʪ쬃5uI8|K{)TIj"91_@` V'6{(䣸4R򪽜بp5_%ESܛErbSuyPjxm,:}dm֥r2O̙R4$=Pj89p|SQN$d2Yk\p>Sfddz'"YTXN3VlxB$/1UȺ:KD_ɕ<_ cܮV^+K%6BXQDY;+fGnZK8uCx7$'0vyT |DRY>ip~wgO*=%=S`Pl{ͥdM߽i d ǡƎDsi崣QNNY攑H9Z;8=sӇr:SGKG;9g3s8xC}YB ~"^@S '7O5Z1MM4]P"p Qۨdft+ j%Z3 M#n_~+xtU~}T~h]S2~C>,K˥V~~-oET+}Yb:Cܒ_ :M;!^5[F*y[ԇS\ K.=ƊNZ|f_;~O~_6h5?O#~ZatjZԙțMf򜸙gh{-:yzI4oy(Yc C0)/w~ttrt8;qKr `?s WEBHQc]iX8H$">#rRdypX 3텟 ;LL_6Ӑc^-}4J_қA:Gq;3<5> "_YOI,=75U/{_:G5lST:9;{"<>yOkGmhǣ8[.ڀĦNsJj jd8fS9pfX+no)ɘj!Q |6ccr9 CfuKuʑӽBцmSZ |RRH(R_D;?Py.5Q9걐9ԪtK^5ձAm1:&)T!ƮL$kqV!n}Tj|(MFM-:x2Fcx] _»7gr'0pߟ2}}p]E\IԋpA#;_Gߌ~$m\6Kt:bK)}m0:Uf\]1aQ؅L+_s.z}Z˕.2Vs7x)SGJQzW=rJ#:pSmH1Ft[%cd&} 9;ͩ%'8\*ρlrnˑ:[(Ҝf'"Vx'$UL^:)tM2NScuze3LL^Y\sd+hEH`ql<:{=-:g[{<9lNLyZ2O~T nZ1_$Ե3}o5^ިT89}%@z&tٌ&Mu/Ea1m;7! /v+_Ol5S-WGޟRN.UKB_'Um(qxGVsu-iGTws%);'_-eFД&_:s{ B&Ï+wEÅC68#ZH\$uQiK?7sգ[΅~ ~oZrbMڒ|G zH*baՈ-B4Uu" r|=+wss~xnGap,)0XBͦ9,cg-fVr[t,5mY^s~*9\t ܕ{,KјˢaO@N ^+;!SY@Mɉӑry!7ʧ$#% D%` dp-",Ŝb)x$+q!ؘ\ N`OB\ϭofL:= Y+&^?^~N{&:>#Lq;榄g"sȂKO固;*&VW!zDO伔%∉OGR|._ 北8M$g .(7IG~l1 ~7 b=] EoЫRRVTE 2UGw[$yOt Ǩ}w/k@)ؔ"kyk( <9,mNT}_:qqVe_<[<}rγ_ u߬'uz3/.5ӿw'΃OvyNNɦ]y{(;_Qvy{)O9S9ڳ477ZZIFτE@3z*tOCA㡧C=hBbhKh[cq~Ȝj`<]* } vj=H? cO]q:V!BFX WӐƓȥ "@ȇ pB^Gi L/ 85y'!6Cn1WLSHi bD版=`< iبX׳caV4Dw~6y<%io,AyCs@s P/o@PzBCoNh:BifKڌHK`ЭfI3WÂps<|Ҫj\WmUh, +#hڮƳoJ`p\fF5^=9\.vt>TWt)^ky2#Bk3 0п?<@g9laB(zz֙Q@%g`lX0~,B%ŀ7 /\V; -#c2^{֘b]/=PjP 'y`߭i5ɼ nG.~=py-Se3ϲ`f\;\ϳr06=,]rYS=Eѯd@po ݋5sprb#}t*_>x4J ~;= x R?V3}.!kni/ԋ.>hEp<*@sreFo3f B'1Ov^2gS @=+깛y(](%E=kA=<ɵlHQOpxڜL2'fpڄ\ ؕp&}#q6hWM=Tu'd/ N}tlOb>ZXIB߂gq(FAY@9@a9˙1$e4ʹ sּJz\؜JpjڜY[3( R]p JI5% AwB!Е>AB\,])P53 x.;]Sv/}.9mAC&Za<]Z8g2 @% J/U500 j!Yȅ^u ZYCgP;_ .4[|pBf ho s'zBpMw f&Ě-p?KÎƚ0D}$uCLo S B{9C8XG{##WNP9|B a 5,! gA^ 2s$nvwH}jGCΘyE_xgZk_g^ֻicyT/6.Le܆SU,+ T|6xsϼMM;j$_P4|QbES7oh#OtRKFdW8Q# b-fnK%5w/u/hw49Lw&o&׽ս""qsV p&33 _p7Rk==jmܽ^N_&(+ҋGiHBj )L+LL#7-=wF>hIahgxYt$ 5çO10MRѱɎ bϨ vG*2Kcnmbv{{{zyQ{{6)b[ = '}2ZA`)K3?:nxn_C-H$҉`  WBJLҿȪjUճߍMJF,7g.!fWQ6kA`^~w^S--#eVhWw:_@r 9…C>\1Qafʨ_)҃sLKXr+SfUpN~K:|S[*Kims:sW=`TX%=/OP~h U#|s:bfBW i'1u<+X5'_hа9x{YC6J:#,_+x-y߮!6S7|ž34nMC6_{=ÿֵ+3rnvgv'>v;A *NBz7C}-P*VR~ګNEPU?uO~vQj-7/-jYwA "bAJoVQ2@4yW Vŀ`S}uSa|-gtZ.Rfݬ wILW]rWfqjtS:D~D4ZN==t죝,veVB'EX$~inC%ß\w]"t#=ܢBzJBso9-1PdvIр]_`OS]yM\g,A[gU]BEU^O iۮEuhBs?TOJKly߯?~pn\|G$Iw߻!HO:?bIl+|ӆAXN +آh]!9·p2#lp+MۏS/N+F2Y8w+4ן+k#E-4S4wlhxK`֧wg,=WUE(q >IyUy7CH6IqOїx@=VS|uYϽ6svU&-qBj\TrhFå?,P\ϺO&>loP&XDJp&5o5N-\! Jzv cX$32nO -Q;M4YAk{|b$WǤi\mVA\=U"C۹mZS-_yn-"\c%D~]d kt&x/dlW6PӉoI=O'8(*uJohH*+xfU6Ox'e5iѿJ#7fԥE.e]ז }M,.]y |RyϬ-S6lP;dFڢ=! FW}NO'7i-iBf7kڀ& `ؒ)FRL*V0X <usqUtp2X)gux:S=#ة XM,lw %Cyyn  ASkO%(HM tFYF:wCFJH(t Hg8FT+ƭBFWLgV=~ӗݖ3fm#kl8TȷYA1uůj`B5BjҕO)gy:RxEj.I$Z+4 > ͕ & _uUAoX =sS-+8[y5i`UTtb+X0i8U[3z jt{wo3[AU%knͺү)횖=x4zapY63q$UgM:aKdDw;xݻJ<ݐi&Umu0/4fm|\>Ǒ{T :#sfoG=m|2O- 8/.,h`&ifĻ0O ȡ2;"'qjT]^3@[m[Nzv林Ksab!;MEA 7f\vzGDI>ը2RZ!Ia {Ɵ8^WUUn֚$zp(weA. El^qaÓ3۔DHl.EoWSw噇pC{n׷C&B]yw8Ôl UoSoWqHF Jc i=sm4F M=vJh}9Yމ`n=2`;o`U*ڂ17L KsRϦX-T+ "r[!ibW,dj0P;+[aA x ޝm-[c;8n3M|o<`=Ȥ.oU|eǨ?e r> | =C*%^Iӕٴ9pSM!=^Lk`@3WN\P:ǹu-\\<ԳV 0=?+6t/p/Ey;ì(K+>ow(8dɨ/T*>EpIی&*nQY>+WT%NdJ.ZӤ|%]BwQ s] )uH{Dowd(z"GuulXT7>fd3=j+Ua\wswv,&ZU+ẛ0U{-X&t<9g\xA+eիi]дmNڛrב3}3zbH!n:WJG[]: *i$(x@q8`l3~Ko4)us%Zi琚b$zр(ox|`$ة ' abe[F9A55Ջ}LE= cnm2g dNPGa)@a`PN?+>Axo_; B!.7#8yL!A !f"|!W|T~[ nE4a|rzZHOcR=ZReɧ~O}۾ WAt;8-cS=z< LʿySA]|;7 EqdA`d$Rxb^׊/θSsU=u(:ጴ Zkf=tY`.M0`VfC5aFZ:m/UHaIXW1&8 3"+JJXwOR*PqQ*~p/.WLxQC/V9Dw}ëB@M]bX=nĽ!G̢]?Ii,f b-U5\,*-tyF/}d/{zR!3KoJ}ZC$a_0?74GğWζ44j d ϪW~-fטsꄥ}mCu<4"`Ȉr BZ~}HnX3|~1ø O lrB?/D`@j{ʅ08bf*&Vf9NWˬnnrX9X_9*|tvIܗ'#:[g%~;gAf#L$,DNe ȴ'7O4]Gw}#D5Ɛa`&4cmä ?Bx0,2V+/+{?6ܯe3vmxJ& Vr/7H,>\040bA'd?o';*LC$s}=z]N ^c#&qC 0مəb^nuf>P%BeumZiڎ8]~(iGW^Y. ]D*` na2MٞՁ=??e<7s8QZI exqi_._ԢroL]f01Χ}  endstream endobj 968 0 obj <>stream x1 Om /NG, endstream endobj 969 0 obj <>stream x1 Omo8 Մ endstream endobj 970 0 obj <>stream x nH@\o endstream endobj 971 0 obj <>stream x  OmGk endstream endobj 972 0 obj <>stream x1 Om . endstream endobj 973 0 obj <>stream x1 Om / endstream endobj 974 0 obj <>stream x1 Omo j endstream endobj 975 0 obj <>stream x  Om7?>9 endstream endobj 976 0 obj <>stream x nH@Г endstream endobj 977 0 obj <>stream x  Omq endstream endobj 978 0 obj <>stream x{@վװ{# PͷI9Vތ2UeIVގ:IWz.GQ\{]kkspggYzzOCgPI:]lq NJ hLξ Z"n r|6@w)<}6@Zn)"9TZBKv^+%o689}N Q l@r7jrܾ1|}k&q;t ,=eQ )@c=Ct',w{ BFW,IfO/bتYsq0cWTKq1Y9]_c̢ZCS8B28R5˟1 >=%7;kqX< o@v.Z2 .n~ w毾83Sh6:;n H>BArtB}N^ㅃ|_j4@:ǽKVxmtN*Z6t U1D> 7UC}}ק+ =#b2|1TK{1;U ڎ h@ +Jtlo$(\gПKc,x5Ncr "|vrY- j>2HӄC䔲Tצpkz7kBi}kgCx}.!P}nŕ\~GN\a}g)w6"xV9lqd+آzTBT?tmƿx[1@\0֜P32JZwYY "B˭\H U6jF\ 7A+7_x5 Y^& =4;% 0I+(mӄ /0A-[ <ohLn8?Is[XV W} cʇ_}F^ 0`-Qa*=-2SUO[Kդ4 i~y'-ư_ n*h͎`O>.3X Ћ T S7,*8dncX;̇υ񵘩iZW<Џ뜼JZ[КE o>j&VlyI*_6~(#E 5+L &~%E Z; K1JfLp!~N)fj& NN>b-PheW]Mj6sU."ý)ƮBR4V"Z`6?$T˧*N3UoEP?FN!q@acWŊ:O `Y Ty7~Qzg:fUw;CxrU:\|GD<@KՇZP3uI )(_8|U+HEv=@'3E: 훷Dd 7_|bHuQt4EGNBR2t`I/8iEJ]Q$C F+|RX} @DR&RT{A$GYsT^ |FWA@>3Ϟ4#/8|QAko'*ۤ_Sz*.ˋR/ a *I>Bs>,vw!pG98{}f?涰.MΖ-[lٲe˖-[lٲe˖-[lٲe˖-[[SSS{n uMfygW, 'јTRpN"-zhЛ ??!59Sh%hah.^L0 X2=%>>gXΝ@sVWڝK+v`i:1YQxz1I{'5b ,V(m3zE8`8Um$ CE&@~^|y`jW2أ,UL@,b -9 G[tI'\/PPNѻ|h{Ax3y^v.;ND/IVorvC /3~0X69`3WpY?>n~Q4N B6Uss#fކ΋,몡h4eܨ7z@^aɄV`^άWEXu`Ekʻ;fݚ<&\>CFO\p!)RDi$ a#K޺h` XǝYHɋKnŘ[a&ܨbL.ȗ*vzLzK,X VOgشs5т+h,D1+^kz`Xd,rҕ M%,z} |3hڮJ0` NKT=t\yEjڳVhHEzTkds_BtٺJ] ] &8ƫIko!yYM{x>hio@Qq ַ6b Gn01S~@)luXR 뤨? x ᢆ<Aaո:v,!}HMC*3 xY5gyQs(;[ޜϾr'OQ. ѩ4t*Rt3.BYH@c)goܖY@v&@A: hP:ЛlFyz/z_\YN@~0],e'ϰsT> 0 .Hx'Q&oss8t%VXk>@ s݃kE ?凅_E8k|{#ŭ8C IYܼt20N?̻eUق4Et`{$[p5"xᔇ:}u{TӨQӼD6RV\SQ>stream x TGg  A]u }&^]}+޺x9|Qxe5y#Qc>4,(D\ߝNڞ鞞|Loկ5h[,!G[uܮ{ykߝ>.v2`)anF'UƦp5cf0Png-"/{^ׅd$`7Z60ՕvJ-0QOph^mU®20Qiɞ~ZI$`Mƞ_NL @n\d&aC0ŧըDyjHN[K|y |uh9FZ{h\sSdo>M22v!g^ʽƞzZî@ÚJVƦKkuOIoot::Ec0<:v~PxU{+WS6Dy %7v%Kݻܹseee߯xAEEŕ+W8`QQQ_|If6ҍ۷~nUddtSed6tP鹨EqjW/a{(c^&/ϠA6o >}Bjkkׯ_߻woE6m*DwA;Xptqo;g~2ri޼*=^7nKhY^J|Q [n_}FU/--;w\F1#I\vK};,X`.a7'-cͮY}JK#~\778yyy2\) #F}qlCI,^Xe##""-2ґ%ծ)Z\1=לbq:e[5z0";>|jt#GXj#K8yqZmJJ/ѹs璒Ƣq< 'N a%<`gmՉgJ8HZ%z&^*/IώS`ݺu63d{w&agvq"2Vy|_ۻ4a;LlJk׮625;;[m&I!"S;="wɶѣG{gΜ:>L>}ҥw,N:a% rssmTɓ'[cCIk;1=6gWFNN>}~׀:.00o߾XDRMŎ,a~Xq rkr =.W#kB{yy}刹{%¡ٳ'cKnL-%\YYU[n*Ǒp?WC"!z煉Ҷmۢd_G6lxt=&.0Gu4+Mr 7D^"\\ Rggk׮BU-daϙ{8tw>}(b*ʕ+֛ B !^jyL26_۟CiB<*+aNwqq٣H^&aܽ{788XyI Hbbbė঒"5R0xw?))IJa4Ϟ&M$=J{{ AH) "*~fS ĉˡ$(t%bСÓe׮](.ؿ?n&aXg"Jzb޼y"TVVa$7,_\MNNNvdK#b̝$ ގ &XjH:Br!uZ[0?)33SMA.̥G8p `L2eB"ӌB=q ݣJX|S*#09s􈲹x".&a5yRVVH:;w$!}R尗׭['R~IS®gϞW$G&a=:iGv )"Xf~m'>H Je ?Y-[1 |0jϜ9#NFF) z Z7YK76ZfϞ-R"2rX /Bzt(++ bX '}֮]+fw`TF,က۷oKOA:&L$,GIg2j.^Z Je ?aMN2EA1 p.]$sQcՁI: C>qyȽK.Ȁ׫pX:0 Y'a9;wZcmmmvvQd|N{5>0 pWܳgرc[nmvISSS333O=H$LuJHXcۭ1U7n܈3k֬ŗĚ޽[7L$\5#>N0 zJ*&au`SNf:߇&ՁINQ sڻXٳ0FJIXl aaj`ګP &au`9"""߯K*͂L~5:0 Raݻw?~ \Ȃ7~l0 p%̡:wm۶ۢHK.&au`SE„SfggK|A$M&`V&:u%L IMMY\\lwٹsqH}MYϐ8?tPɎ5ʦ5)o!Ty*@o}v[=U %?==}˖-̞9sŋW^-,,tRnn'vڅ᭷ SX,еS+`0 `0 `0 `0 `0 `0 `0 `0 `0 `0 `oo߉WMtЁ"Ruؑ &3@a|pn${xArq[4rYr(Bxzz-_|ŊK.:u*Luuu>qIOO'YxITT-Ĥ n߾M;m۶(ILL$)ܻw͍`ܹU{x)x9kzUINh*Kifɒ%׮]O>6lhU!""⫯6ijEEڵkcccɂa_0*ݼy+WQ K.I ϛ7p(;A˻B5傱{l ʢs~Ykjj Mˈa_ϻ>>>JM |2 ~z\0w=Gb_znnqj$ nذ85xŝ;w*j:d|SSSk=z4_7_iLώ{EɓpFFcǎ:~[F. F^M{\gΜ UpLL $+WLƀ"Jpp0b94_)۽9HƍС hi%$$@$)LG)tA֬YS^̰缼<3tݹsgXMo׮]M>Cך#;Pj L&s%(urԮ;螺Knj# 'NԠ7|SZmhh(˗oݺ b(>kvf͚!۶m[l\^zi_|Xti>}޽;87md,Zh˖-_~y!OA6mڌ1%؃gϞ&!ԃs9vԉaF^/^e:k֬({g+"`2eTK"xxx\SSM2\zSB٤yDFFj mn9Hm*H_~ 6n(0Gh#¨$|:x`kG@3fU28|ttp j~x{k'MVF~޽{_7J9 Ը89Wn.]ċйyyyX֭#lT$:k LH"YYYИUTТpp,@"M%*:u*hB(+a0@NWG 6X9B.y7˅.+\^D"ax͠eeeӧ^~#;E$<.+\^qh}"Pr6F t2wiѪ;vkfFK!k&pȗӧO70Ce\QdGK&Lzz{H`zjGq5-/~jGv/\IR/$hvMD5ب&2sÇSNb"aPߣG!ѽ-a7|3x 0 H!77}BȂ c1ϣ%L|Et21.?Yj :5y79 A@܀=zpɽL< {1}Cxeҡ7} 6NؤOHcъq㤔qMH;HͻHD 'sΑ;K"bx%)@hG&PL7bЧ$! Q.\(^]A}@\\L~B;Ą̓0Z&܅ɓ'1 ㍶D1z1rF0:O˜VL8n9j Y3[g2dƍc5k,Fƶ}{6:Lɉ6O+WuC`L"붴/ߪU,޽{w"2. ZȁHt%!˛gaI'Q4ތ K߿£eb6/^L@ȸ1III!Q3(>>^<4QLL +\wi0jxהx K-TYpK!T'f(Ꮪw>qoYbٲe$:`nH aC'ZWy) I$ҥKӢAxx̘1L.n11e1X㴄oݺeڡ/=8G|uV=-nH?NYЋZO6@kƾ+%\UUuST,=(aϧ#۷O>-a4Hs V.ҺA²,N/1 ]CɓOҌ~D⤐1@5[f@;"`mcxx8-^zr W3f 6TO6 y)Ƽ޸++E酁Gaъta)c.0K&"4oEZ'%(&AͮI<;&HtL6>}o6mqDZ˜p"a&wۀA =6-U!D$eE$ %_tP.~:PYTlIFܹ#N+{SIp~.KGY4Ei&àԑ0ԛ)!CDNLLLJJ5jmF'7f֬Y Y6m OSCKg`ɮ]L JU6$ޝU+B4r[b4UQmD &]G~z^UG¸d&g]\g̙3KLQy3+V_0@0̳DiN͛?7Љ4$ j+uÖ"vsrc~N?! `~oɒ%tj;w^w3L0GkRG6zf:K{Kb)+aH~ݳg/rrrIKK# ^vMv҅dH~jHݻ\Rcw0wJ*T.lB[9 u]|"nݢ:~ɓחN5kF@D C?vjr -FײZM%#ަ/./o}z Z`^gG)$'z;G}D~j`#G鯿o #K7p@c}0!!r!\7Dk={#GH^A>#AkhtCtV4$\gXESDԵkו+W Y0Hի䧬,Q2x3ᢓgUxהq-B7)))z0sL)G7< C7ZQ\·cz խ[7Fd!e3u\D6ĉy&anL36g:] OhcA_G6-+"a-gbWNzѣfu$1 <ϝVPwbz~٢-^^^h~lY#c`CYs=Ç7ͩ&ጌ ǎ.\sbvc ͛:|."F-azE ߈3}Diڴ)cy|g$ :|isj ɓ'I,q:1 l#u"l"?kd`oSG/_vyʔ)K,ԩ"]DSϧoTWW={c0= vΟ?O[4srM. ر0y@ &$K8={f7o:o ˗/bAĘE' >stream JFIF``ZExifMM*JQQQC    $.' ",#(7),01444'9=82<.342C  2!!22222222222222222222222222222222222222222222222222" }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?4g.P2kO ml 4mp{xb)9֜0zU Rb*ˊ~5TXw-*JcM Q )Ry`BQHzC8&dZ.ES)2:Ux4m4b`"qM(XcV84`SB#qJV(F(!ڐR)bgڊ1J=h((fiGp)E)jny֌ R)ZCE%A4h fi)( Fi(ih4PKIZC 8R4QFN:P1ht LRcFyHݎ,+P2}iw%ߚL2()&hER]g&P&JvH\MLSw¸4f>P+ KE%:s@ Q -!N`QҀi駑@Acp^)1@\G fE}hm48,7b#ݴݧ5/!\74mTNG(sDO2:UO3 y.\OWȪBJw\s"e'(+ҫX.Z֓Ab̢r^)p*2-슮$R+ZV ܘ&i9agAivfiM4ibSv4J(S34 Ow4aA4 )ḥaCu  RJiJTSH\V*-J֢eRb nEFAERd"&8'fiDLS6,3iP! \jN)MiM74OƐM1z($O'Ki1LP.)xiqJi4:1PiHڐ %bړKRymKE&){uhGGj1Hc3I&Svl9HjMRm6K)q ZQbbRh=)S )E!zS%i&Q)ў)qF)K:Sh-@ Qx@bQNm Җh04-;4wԸLZLm-){֘ Ҋ^0QPEQ(G֓.((jyf3w4n Qw$-HOJf7S n>٢$.i 2{Qa\q,qiyc@hF8 ўi⒀H>y>3&h&S7RnrMԡjԻ\5/PzPR\/Z5.h,*liX/kuJ,;?Tӄa7q?7_CK9n(3qTq|ţpOziz,;3I?USć5-1R^i)44c75 ɁK0cB皙cޫ>i6#n9U4SHM40YdݼӸWjVi bɱV.ѓFwӏSң 6!m zNi=E S)ژ"=i b"iM"$y.(43~ P&z&F.4ͧ6pN);hsSFsEXmHHEd&(u0Z8ӓLɠW%$RS0HPdP3HA'@ PHT҅4hxHddR`iJW KiH ޗSѶGM(EkPV JV}ӶS4:Qpӎ 4bdds7oMHVX7)\Sv@'cQ@XnE⍾Lњ6RLfE&Qqf1N)q@ 4c4PsF)ؠ mGN N1FRS&(S攭bhbZOz@H(4Š(;QHQ4&( @4Q f4RP1 R@wi<"E!cRc$+h+@ijR3@ -8 ґ@Ɗ(Eւ)9.) 19cmN)sK.43\R\fFv)h 4q@0 ]ӱG4 ! \R.i3M# ioҘHiP & H@2<PO:Qq$7f)Bө 10) 搶 79.?4ޚ 5PydwSI' PҁGz`%-RB(QGjRQ@S{SԔ2)P!)i:0u=)h@ \ R@Hb`Q֗QP!-(ޔ xȶѶN9b\SH[FLV+6ԅM4 R{Sq@ӱKf(BqMҀͦ.h@D LR qzԋOP44W=*`42ڔ.N"n+w&ÚMpڀҟQAb<{RRn(FLiMۊLArPw/<@z@2A39i t }s)p9DV3ÔVEHc(ҏ,{nJ_(ҟ0r3j:TxRr܋QSYsOfB Zi*rRN@&EJqJ.+ю)8h ߊMSHv)6ъwvM#9+Eb&8.+4=)8E7ӇF:4\,Gc'.FiSL,V)"&c hnzSt4ҫIj\b\֘~ v$谮HZpaΗ#"ZvM=)w RM z3@<`@'i:s2:M&L8M8iBv) 8I1Q Y11zR)N^1J4R3@)].@4neTLFxFy4!134K3R7v)*wt&!.h})vsHI;ob)TeҁH4 >@IJi i3K( c58`Rfqv)3HhN)i1LF)qQ@ SH6@Fh4P0(P(4Q`'zZ? J;QGGz@Q(@)4R)PLS);ӻ ږa]SMM7PviwFIiA4;`N}i+ jRMJ%U i4>f\1֑jN +r`(X.(RUirzRhiFګC.xbS&)JXMibhWzwj:QFiЂ9O9J *\s&.ўi@ ޏ“1s< pJ3 P'48,hjE)62)6)(CvIR3IXj]E JiґI4!$v{b*T)6`STa8 rJBHP:SZ"v9,ARL g2X`.C1(Hd"ӎӰHXM=zӰ87wcIM U`cHRIZ[ޘ j@x4SO=)'}iކmҁNip\P9ԙb( ǭ lNinw/f#!#FO4,})ԠRwGj1O2)1L;ul␆1Oh4IxZ^ԂR44g5&)<i1IKELcۊi"JQ0☙UңV$U,GҚ}iFG4:T1SqHG4 `IRIۚE5-!tD{M. ?P; /Z^j\PM;P!<'nsKHxF:q@ 4I4!IJh(RPB(bw'z^^(4{HC{Rv78dT@&)qHcv0RGIqNFi!h1NaRfR{R@ IEb4{xKhRqFhh@LRRS"GjZ0)(GJQF9qCSm.3Cg٦mC] >ʱJihh4EE;oZsKGꛎB&;!)3@ >h)hOJB{S3E8N=z) (2ML0)GZvӿ  wHXP]ޚLyƸY2jIli@PQ%Ȳ O8MiW)*E0jiW*1t=j&'U,h5'6NfqPIEL^j1NqsIJ?ɦ z(AҜ=iqK) !@@R+qu=N);Mȧ (7ޗpcJ_e@ iqҔ!l 444Qޗ#F[(VW@ nI!4HZ9sRh iå4Ƞqn!=)vijz&c!IKTvʌm\,F.1RcFEb,R6ӂ QK4RcCጊ@=Bd)Q!Z40*NqO.R%8jNj&HǒQoXMǗȦ)x1h,IN @\L~4}xތKMFh\@ ޝPh5MP%F[i=)!4܌R4̚(;3ih,%wj!)P! 9h7ERQKE4`LB'?ց )1;'ZN0)3@ )ۍ4Q@7S3sދ ~Mf 㸧qQ sKcqHOv%@ ;ihQCր֗u.9vX R7pl,;AN&$٨CSRh.N iexN sMJrb53&M; Fi2*oRc(Pi=i1Ja4T]Rh晰նE;b SJm 8 w ӷӶR柼-<)lzBiZjZheNiwsHc&mJE7RHdA)5 0擭<ޙL8QhS(44QP; PiQ@"P5"@hQRxW)hJ9'NZ.3@vcvMS&x`Rb&bc8N:FO֘e< DRCSKg75DL3A4ME zJ(@X(`4JJ%-%-!(Kڀ`pE& )yQڃ@;@h() AKKIހJ(i9"y4gJ3?oxZ(h&( P11KҌsNRsKK Ǩb/iFi;\hSSQHi H88T17ʞVab:^(J.1<Jަm(ӀZ^3Hb⟓c,\n@њ)p17';<9 p r)SId̨3FqEasPnybxZIH\&)%E3v M98i>yLBhRw; ҥQ@> *` MLJ!n)a_Qrh-7pLgq&:T &M4g5 5=PTK~QL#Žj0/݇8&@Rnb4ʼ nL-N.y2(8N@j6 *E\,B)Lxdp8-b^i78 [V`(r1M)Z-{P-Q*m#h liڎtg=(UI*?/)V h"9 sU܌M14"58Dm11ƐK@ъwzEILBRfIހO-JvRbwJ vGzeJ=iҌpSqA4pȦGoz)!4Fh?4 vM/Np❷=)jP1I3K{S=x0j\sOvZ3HO!?: KTe6/ުĶJ[. 44qFO!4;ؤZJCҏJblZJv)( IN&(tix%/z(wҖh PEJZ((EQAbds@ H(K(P1 P#cb*)EE˱o>.)aII. Sq&1L,39⒋Rmъb<{QRb\t)RJCG4TEq@7m8-( @74jn47mo4=)8ԣҝ68%b<Ɨ Fi\,)ؤ+LcOJ;KiZ]sKvhM(jp|uZ))DŽV-mMǭCCr=iY1GFfHe`&(Qi aL8j6vɋ nzښ^rR-ԙMq=j Ի)4ۍ.;sEr]nJ^X.;xZ7SM(ROjU 87RPp43@F֚M+ d旚vcRfdъA֞0 c]x+F qQ\qQ|LM/5'ߵ9cImD"zŃz!j[*h֌җw 12j&j((RHw_85NzҳkhiuQjM4lJޫ{|xĥ3# Ӹ=)GPoOnyDJ]7ZЉg* ڈ䚙f*c1@&9P1A査қiei6S)LCHǵ.i `i) PA4g'Iژ E'9@\8i RQޘ>ԙf)4gJ3@fBh?&u4Ih\ԝ&Byv㞴晚)&<ڒ @%-4QERw6IۊREN/zL@fҌQ;bQKI@ފ@hwBP:R@ERaQqKJ`ElQ9AQr8svi~ZBx \c)M(#(hPN(ZMI0{~7Nb8LB4RP:1r)(9/nE)wS3I\yFX`&}h2Qn o4yE\2s1=j,њ,ls94$QގsLZ(斜(c"TyH sNOZҸ iGH拀)h(!l JuPJ*f⊡ &)s@挌RLP (F)y4)qK( IR@ IKRc`G GSEZNRw CJh@ؙGԔv ;Eҗ'ZZ QڎhRi(B)>ZN( ZBiH0-Eg(a֊(,& qE -%=h3IKHh/I@Gzp;E!((CKڒh4P!)G"/Ja-i(Evp6(aE-*R44`j803L杅qLK~56BgқR⎴&)28M|S.){qG&8P$IGIHjLU-] e8%)<?wFR$@ zQ`HGJOnšRKE2tR2Rbb9T9ǎiV!E?o&Nvs@NBM9? IN!A֌ .8%qJ3mRO\vKNJ+KN .!NbrC p4zSZJC%,F[!jvw_344֓qH:.9P◌{CM`@f1uZCDR A\fݚ]‹M7vґޚD{IP&w4ln*R45Bdt+ސ-0ӱIҘ 4b 3IFyAPM&h4I"+EB})i)y<Üғ/֓ڀvR Z("Z8f(bLqGj.i){P A֎L@ @uzCFE'8P+M ZN ;QE(GjZN.4J(`IKE`)i? -'PEPփE/4 LQAE(@4QF(tJqG()hE`isEAHzRRP1{RE)( (t4f35,\s!ZQ@cqjb1M4M!6<:3N¸ISwdg)-/#n4bGj)F8.ySy.iKfy.IޖA֊) P8u{P0:fNԁKڣ-ML siaQo&4D[7SH_4F{`$ H[4̊3NؤgLњh.9y4QLA֊;RzMq@E-'ZbQZL (@zKERR ZJ3PEPIKEсZZJ:P(hP+1;Q^P0PQK@RRP 'zZ;>QKHzX(4@ii(Q(@/n);@sעAIizQ’@Q@\)N}))h E/zA@lv}(bR@%-gڗڊZ )M%R}h@-;(QE Ef挃URɬ.٦h4MpKcLǭNzTAAaE;i`JqHiS{ڂD=))hRSxRJڍJ? 0{ӳҀLS7i8!oSHqFSwRfg\ɦF(fv Fi1hP3K\RF(hb%.)3Fh4mJ@%w8):c0sHbcgh~(@34f(  ,3(;aFt!4!ڛ(cZ3sQizc !i0iLRbTѶ SK7Jv);t{RKCbRsKހԧIր𥤠юhx@@^ҁ\(h@\(@õ: w4PJ)hhP; E-%aEP4 9֖(@gRR {E@ږ Z9Aڎآ NQGjޗ>Ԕb);P Bh1i)h4Gz)hKGRc&NQ@X(((K@)h%/jN){RP :Gj(Q@֡@RwD-&)~ LQKE( E/Z(:\ъ5 ('vAzR䃭J*OjO%֝JMJ#AH;SH杌Lc 1M;m=0jmҴ+2Ā7 7拍3o4jLsHAaLIIޘXo4lQqXLojM; sҞ&zRҙ.< vWKSNsJazR4n4y KN Qӂ M—pZ;n (*Gm❸PH֋#IN4@qLC1N⍴ oJJNM-!LzӻRapT;JLM¢zRn`!aM-L$JvM4v-&iJ;QژAKE'Z\`Rv@ S%iҖ֘ #iqHW7b1L,7N;SIE)p(@ JJv2i8qNҝ%-v`f(Fh.J(ERu ;R/jJ KIbRҚJ(Qځ(-Fh J\Q@R@AZJ8Q-'zZNE(@ G-%QKPyqIpSI@1E Qޖ9E- QK(v h)ݩ1E8Lih" ΌqE (K@hPhQGҊ(cK)3EH((P1((&ϭ Jde8=CGjVb}nPMɳisPnR{7ދ䁈j ovj3֍Ԭ'3QwH 40Eb@hL( ? t7܊ilQa\u*C҆4Xw,o( C]Ұ\R=i 6 Rcv:`}(4fԛi)xny$T N#VJLIi3;&xiiXhvsP!)E'z`6i0hQRbmҌGj QF(u M4t8h4P0ڒR@3HE11ӹB)&N(qF)f)1Rm"Rwwǥ1Xn8iHf(REE;8%u41L^@h4Q@\8IKE!Kz( EQI@\Z9%RQEPޒ@ý%/Z(vhϵ%-%-IIKI.;4{Q@؞ԣhJ8Ps\Q(JLtNQK@16)x@&;KGzh ZN Q@ ZNBQKHhQhEv!b4bJ1KE JZ %x0( 1*D%.{ցsNڔR;CGZ11 GJ^Ԙ:RvpKH:@ E QRsKhg\)s@SAwz 7= ZFhhavi`!Qfxw1Ⓨ֗4㨦~h L&hB]zQ,;#֙P+nzxsEKMDI&hGh敂4.h u.Fj<ўhCJn}i{P1GJCրyis@h֓4n+ޓ4jijSL4%8RJ8j:QC ;RuiE/4LsJ&E.tb⍹ lFxP,捴0LBc)qNgBQGjbRh "\SRPȣhKGL,'zJZ) wŠ^%Q@ ^ J(4Pږ((9P1)h斁XOca3ARɠl))qGjLQޗ'4 šNqEĢv P$faH~P!(aEZ((bJ(PQKW (A`v=ĥ6-%-A(G(BQKHhPh=(EPGҊ&1Kڊ(3EPh)E&)q@y=Rh>-6@=h4!Iږ΁-D0i;+isF9N0qEBސړ4`qi3hz;@Aۊ(hږh(i1/`(:SKai@ K1N@s@(OAvANI@fibgh(4fڊɤ&FiS֓));@ iqGZ8.i;Ss8LZi4nq)hĊL{Rd3M@FE7)F bj1@ 6ma&(3Ԙ1!QZ=7iZ3@Xn8uJ1^i( Z)1J9 _–/zAK@AFi1E4fAK@ Lh҂:bړJ0hBڊN)GJ3H3KK@EP})1Nm){P h4v0E&h4h٤67qsIh?J]H5czb Pa(:QpZ\R@ *F)v1FR*إ~) `3W5:0'Dt40拰qLR*r ?L%Qx1HY<4lb5!qVHgR RRg3@4Xa3H(@;5zx@\:\(/'QLEb@ GjNsڊ (Q@P)3(SqEXҙ֝@C4rUhr8lfB=j"GzͣE"4ʄHM(n6מ${taܰH|Ѹ@YqڙU3M)WPN)ǎ$RݢOj? җ=2)M#V$qIߥ4,i֚E>iN);SQG1'zZC@“b@-%ZpI9hGSF8 hhNh-7ъq-'z`!(JJQҎPQ(Gz(&QF9 @yEE&h(v- Nh(sGj38@\(Z'PPE:RԤq@ j1NqF=8bRQOipHJ G(h(KE E/joAKA'OƔ(PF}(GQڏ“4ţ))jC@1fԄ;R`-( RLb ރFh$ oZZQEE/JN3F}(48NF;P 1; 0 RvQ(⒊ (hhz@x>3Fhu(`zRڊ1F(h@!ZJ(i844qA4fwC4gaq?Zi.)@旵BPh4bX;RR ZJ?:Z&(4f4s@g!N) cS9`,zQ'=jy6(ӱhi@ZS>blYdJw1+児c åTϵ.MJz =sIGq fK*CM ccNqւtILF)isژmH~i`R`Lz0%?Rbwc h4R@ISQ( Rӂѷ4\v4bGz@3R4n%!%K%!bi)h" E.)9@bP4'GjvMuN 1G.( ӱ1@ 4cڀsNa1@Yc֟Pj1~ %F(Q@f^Mb R▁!I@h 5$ڐHzPqb mԸJJu6֔@RPh\O)qE0(P wQQ<.QڗڌP;XNxGjChҀ^bh7. ii;R =sKEw'zZ`R})^f4h)QG((4Qހw))sHhz;ۭQGjAҁ GJ IKGz!@(phK@ĢPEP (c:Z\RuJ@/l֌I@ФqI)3(ih@ Z; f1@.h4 i)phNɤiy Ӌ`SyM!3FNxE(JqJ&RRmȩ1!b"[1P&iǥGPg֙҂8oLSI!ڔ;a4f(4Q@XQF):QwjmP;&)iRFh  @HuZ sKIZBhQ%IE'z,f(4fKgz3@.Z8.h,j~4Q@ ABOƜhn}KF( A֌~ 9%wz) =}(tG4R恉=MZiK( Z(R)(ϵG{PH%w)JL:}hb{ގR ) PF9^J1KE%P}ɣҌRPGj4\N1@ KJy<(;4ϵZ3}h4))Z 'Z1@4vJ9xqF=4ZOvKIL,'(Q֝),%-bwQEBqKGڊ(Ph{ъZJ)i(;P4QK@ 斗(;}h>ԂԸ,w(AGiqI@!GS@tGҀ ZJsފ(aE-%%4 )9杊(bLPqR,'M%RF)h%Kފ'ZAJZ3@@F)i0N4’ CҊ((4Qڀ CE'jZ9l'֏zu&90($J=3L`)i9&?Zb Ju&(=h8W0 J}! m'JvZ1@6𥥠t%PqEmD(;R}(i1GҎs@(@'4})FhJQE1(% KK\{Q@:R❊1L,7bފn(Kގ bi٤c3A4 1%-J? ^vK)L@õ%/>(Pڒ( 4vWEPJ^Ը%b(PGjZ(K(BA44G^)(Cړ.Nhϭ-13Kn1G4L@ F)h4}(<jC֔@Rw `'҃FqFhb3@ QފhNf4PIS@)so4PZJ(4 (I@{R((>J^w Z; ;RK1v)CE(&(RݼQP22T!}0)6C&idxRSPQh{RъBq@ IҖ (E1Q֐qI@ŒQ;P Z'@KSQE-'j^hɥހQQQJ8C) 1J3ҁxMK0q@XEKڐ4\,EhIM*\SPVc1OFJ? ;ԛyEѴQq؆84q ތԤƂ)G4 4/RQ@P1MH4qPz(0QILIGjLw@8 R)1NO⎆@M;'z8J)hHQJ3@(.h+6u@E&)sGLGz(-wJL Z1HғGZ\bwP44Ғ 1F)4iRTi1gE?h&9BR⒀ Lvv:PESqIKI:Eb0Ef袗ځJ)qIށ4^ؤ~4 ;R ((&(L)hE'z;RLw.);E/z8bwN46zRPIڊ\M-iyK@\w"qMIҀh$搞(diĊB(X@hZ\tP )1E/jwH))h4hX1F)i43-'J(ƚGz^P)1KIRi(QE)Z0\RR)i1.)旚J QњAQfVC sFQbdfiۨ3H@ RqCHR)3Fi2('ZNiZQ֗`恜4!3O44HJo4b}(P!@\h"sKEZ@4c=)@&(.94){RmaQ@j'9 LQ@!qF( 旷ZNhǽ'֜G4 K)2M)(Kn(;3L /)i)2sHSiGZ3G 3GsI &M&4dSsޏ0FiJIޓ@ɢڃ@GJ(-%RbP Ġu(vp(hI@%P!1ERъ.R@ E-K(E-%ҞԇF(aH=y4P GJZO-vBQE!Gz)Rh@撎('Z( ފm4\њ)P0IڔtAGQ@%- LQKI@Q@Q@tKڎ (;wRN&(QGI@ Ev\QN(Q%-4fmFOj?\b<}hFOj;'i(7SsE133-zi)3Kڣ('rNhLh@sKfxwX '!# Sr3IL@qGj' g ⟳m4.;❶1N; z6ԀLl7mځ iI)E;'hm&hъ_zJ(%%/zJ;b2hPG֊(ih JZJ`9K(J;Ţ>pQۚC J9)CJ(i8v 9aZ1G8@RF(Qނ*ZNJLu8SRuPIN=)(4 =h4{ c>fAڌQJRqAE(Hsӊ;E1IKK@Q@G4 9fi(vb sIKi(PhEwc (E & -1G4^簣b0 GZZJ`ÜbI@I/=JZ(v񤢎4<њ2h-P3oqo9?'Sd6.h^4J/SK:Pc'j@{bȶQ5.3F֕ÔD}ipjMڠ#&# IyLVǽ;(*3sJbFEޗOZ;" ފ\Rw=(昂RHbQK@uPy(Ph(RP֔PyL8QKHE zQGj((QwRtRQ@c(-!.:Qz^ w=)v7Rc~3K 7RPR(h:fG (1Z1E: Gj\Qa)?wjLScފQ'zJ)hP(KLސԼRuzb ^HyNIL,7"^ԔRRPQ-&1$:uB}(z(uPQZNv(PE(=(ŽbԘZN ;QZ\vXCҊZLP Q9bPGi{P;Btc474BIJ1@QO(Q-(QIށoJLq<+hG1F).8Dx e)h0;@)i1@'zZ1@ý!)JQ@S`PzQրQ@Q@nԴRb9H)٠) !ZpniqN cqL84ZAbӸGM椤4dQڟRS}(>Qqqa{CvmHs1NwQ7斓 8P M 4fLP֎uZ鲓J-iUI[/< :sIٜyM`U7RJ6+Spidh;ڌS;P!1IN*M&1֘ E.);Q)Q֗aڌS▐ IL◵P)ݩ1ސ47.)qKހE;{Pu`P 9)FBS}cqF)H!=iiPwvW)qiZJ)i1Lv (GZwjJ(ӊN(xMϵ:ģ44RwiƌP Ҋ@ yvcLS;Rb4~R=⒀KE-4)LqE/G \Pf)h( RRm:ڐPhQE%-c3F}( E &ŢSRMK@-a\Rgih1F1K:OŒwhR恌"ѷbSȤ&0`}h#ޝ\< 3F(ъq 0iE0 B)qI7(hF&)rik"c;SF9(4(h@>RǪJ)w Eh; ђ)K@OnN$RLK&SqA9d!Tf K4.)W˜Rԡ^ YN51jIN=)34HP)1R*4URIlEW\V5"&i 5v(^5DsLX>*MǮ)05r܉%HiXؘHZC(#J= ?#GO04,I3L(6 *i VGj.&ZxԻNh b6<}jQK@1RD .1Os4nPmRsIi1O97b 8)=c9 MaqHPԹi\" sF*Ca4ŠsN#֓4&!p1KKEn(NuF:S*^qLBaazC1 Q{fF)ԘĤQ@b=Qu%'JLRz!(Kޓ`!QNԽi1LaKJ^)u3@zJZNhh^1E7-pQIO4`SMGlө:!(&)RQ@7 ;GZbii0hhE(ր\P w4@v{P:s@ Fh43E%!4E6PΔm-/~)(ZNLqIފ@;Ԁ3@ wjh4d@FHL@)qFhɠI LbN9ޗ4\qGJ`&h^ԘRhhnS|;VF;T%k漥BgI'4jrͽiܛ ӱIORS.MA#i꽍!SH#֠,GqR␊b(HEa lҰҘRf3Ҁ*G4n=OHy(l)6ƬHAzM($;IDx+ҀML#n3RhrJ՗OңKt15O&=ldc`V|P 10:W j3R2*KW+#Iǽ<Ǵg5'CYr)N5f(F@ǞԹR!J6yX0FzwbTpSiF([&h=*-hLF{U\V# TW`:ԩ3WRQPbng:&;UUBAG5bFѓҧsRbALv[bA*yIbs `O PJarҭqSqE(ޥo5/Ni2<3cޠxLtVAP:SS"&(뎔Х+"9P:ZwŠ]➫@CLxu#mBS\4NFi6mҏ/*"+Iq=)\,FVVM#; Ѵ;@`TqHˎqiDt6Pz@Xoj;t qKI}((bvaIҗGҘ ZNii{i}@i{RQ@J-7;(SIK1@}) =i:NN1@j>QҀ Qhp")sKewP@N⒁ELM ԔSq/z1⁚^PEz BbRiq@ PR^٠ @sKIG4Z;QޖJN JNuLE-!4QJ9ȣ4gbSɤLPR3a#u)|RpMr9lGnp1 d 4pj|n4]=#597 9qXѕ֣%)S/4Xru@4X$M&NE ["4ZsN¸fA֗ p#ڐK0zhRXy֚NGJ\[֣'9z&Y24CRɨv4D0F)<⤅ *GX&MNJx;+$¬͚nj\ZE,qʜVģQI|sn)u5,vHKbCEcͿVkȡi)i6-+U\D#hK@ǷFA[+ҩ2,1C'[Vqcrj`Rr)oZEKMSz T4h7k()J#` *('ivޝķ.8kE"nP8I6qi@lU-CC{NⰪ44 ԉlҸ1#JPMi(Sߵ":w:SLTl4 }*"G4J5I o«HT@Td Kd>X 3N"`SlI JM?p'k9!1Aڠw5I hޡZp5V&('  g  ^U:PaMj&$MiRF*#&ȥTQ;Ԁ1Syx4\,B)1=)V"MJVb$Rrҹ Ҭ,~= 0Y9\ז-=͞;4JipXaLdsJaL1 ՒS6u 58)RK 1%/jLP ഡhqE)4QE џz0 3Gj1bii@ @b)sJ2)أ\ъxZ1)\,3h&f)" K< ތSrh4JBG4ӰW4;֊bWbGlhSR`AҜiCYM|/8⋎KE&^T|+PՋL{2Ni0j!(ȣ)׵!ܐMF3\wE1+MUdEw1iSs4 P)25V=ؤ4i'E)N0:RĤS9- 16R5 Bz!8sN*;T;P%pȫ-1R4bɔxQ2լdbSbhSA5eWڛ$B[X✉V"ՔiMN [B  Tzf.U+FAQѨhzic֔zFnI2]v3Zzi Y 6*##3Jqja\XTsT&C悸S`_aeXN hYIrx|o,yuhs=hRX: MsvѲ}\V#4m5.3M pqMe@xM&6iqސiaGbRJ3ހ .8J@78Enja\TRISMP3SJ(SF)hR&S-.)\i J͹M*3R⍂;((j`Ի3Ei Տ/ڏ&i@>WQb;)Oj6bbO.n 3ɧ`tmg9@O{QP6i56Þ\v+yd҈O]X3PlԦVXU"dvP4Q`1aLEN R3cvib47ޑx7|-+MS#$&Q.80HHw%eWx;|ID9jWD ƤmP48Hc*crZ*an:SvZ4:Ѐ(,{Sw♑zvwg(BS@&!Cn20:&@`Ro]8AzR'^o~ҹnKا`(;['HviI(jPF)6; 5hۚW1֤zӰqNٞiKIRz zBi)MPU$BLS/*y1hqULS|)2.!T|syQŇqw5 4D9{>ax'h7֟bEQu=j6&*=Ě\{a 0h.(GjpҌSHOG'@ͤт h'֝g4R1@$4 \sOi♶9/OywA拠 #ޛjc ҋ4Wǭ'zJy<̂̇`&oN!O.a6_,bԾH"~㊍ڟ04, \6߳*bJ<``p\IsK|AizS 8MLe9CmQa銾tKfrnjI5}tY9) Ĭj8ǁҋ `Sr{s6ӸXSRH` "$此\S\zԂ0*ϐOjp\(y=:ӄ8pCHyF8 k5:Ca9@ Hb>kҧJXqҜ#>s T(@GJb&"5.CH_JO-}*؏ڗ0JN QR y\SLkm& bS*v(  L1`*JiZjLJ j'w|!hښL)!EiC҃ 3HگE7톜g$U)=*2t&SUke.= X?Jn)`fiXb1Q?/OjxoJwHVDW4U.RI)9+a_jc;MHV+cv)3N{ӸH Y i` Ov+:R8( 4 5Q@ ?50(-MsP=Ƥ8#D5=COu\Ui2Il#a H.GJLC^; 6OU )\ϥ&jb@ҋ@*&\T4\iܖW+M+WaZb-@!B)"nMc1@@ ^ivS،i};;09S0ʜU"ZJ1KhZ@iv0G996azR$C.*Lg8&zW9i>j<)\v!HT.#lRm4R)4P4xOU9R*q+œjzU@5-,@UctEb5C'ҌS1# Rn&DTL2jr1sG|=sR8=(hUJf |*}U(|+G4+"Zp Nerm'5&PƢD#{T4*տ/֍0r@O57)RB"4*\ 9pLTǭMÔ/8-;".`c4iIws@f4n)hȤ&9I ([c8$)E}.KCL4SvҊbE7HԙL,BWhٚyx+ iD )IK)WI) 3ZLhBTO0\T%LLJ»5K.)™ivYdlri^j+4W*aXژsV)M?j=*bnIo,嚗8v?}9g@AREa4T )"ù&㟥.x_"q8i&<ӳu3ژG/W MU\,qIz⛏ZH%.2x`◥-3r)iIL)Ԕ&.3ҝ"qHcKg RlvO QRmKcQ# pJuWsIŒ֕"ۊB(=hX˦uc\,Byx(^xдl.(Z~0E4 sKSS  ҅() 6ҁӀ&11Fh"3J pn)۪1Ji e8SMH}u&ix4<NqH4(1 Ri3I)w @44J`)1QsJ 8"@(;&9,&i3ތm0 m'8)ir(jLR\vF(P[DMHIsF |±XhEGj( zVj"TAdy9O.xjvF(38YJJ"4EJ֮iKJ ٳVF8r)O4nX4Ú.ȏPzQ)y( Jn GހJwN A3N.jFERъh)QIh zQEG}BT liEMҼh)qK@&=B斗 TQNi61;F( 8 S@ HiqK(P2ئ#V⛚i45HB;IhC);SPRDz LRc U4gU{SJ㠩J]+ Q 1O+ګN73\TM=+U CR<~)6JwUs O:U)S6>|uG;Sf.,2LZPOGh F'Jù)9ZFta\"x za9D9LQc5VH.O7i4X.#`J#8I*E J;)q&WR/hHǥHT K#T|Qr3S[D( r FTR&D +֘G4ipi=A=<3IO=iJ(MF EDIJ*b˩F+ιEg56)1Em!QRIEx)0) Q SI#M+RL;6Ԙ;&i 4 R&tvRmFh@7SvԔqI4\I\Qqb.6DIRhp#iiEGqF((/fRfu?S|FJ-&i7/M.=iW%!j74%&5 X.M57{Ӱi8op4oBsIK M%%)<)}i>Bcrhɢn"sLB4`&;Rm4ݦΔMZMM2)CSsND~]*O,|AF)3)(q`4&)N\,FVE=ڙ!ԇ=9K#/IR:DN*KfM7w\R3L+NIGMojol6 ǵj} bo?Z:QSXzQk>yY9Y[U;Ry~s ;4AJi.d;VD*yJ)=Ќ{R}($7 >R"K?Bj=q&ꌽ&N¹6sڊ{v,M PH5cv5(zZQ8IKf7`psJ%K ڌ'yy)s0iZ"죘v!TLd9p)wJMPCJx4 v*JBN}(uAҍX.X0DdZvi`4SOJgHdfl̤PƞQFj3%44.Pf DXf9FaES2S@4fZN۩3IFi4=iSF(" 7 ;hoXlQdCSJ nm)Mғ4H4hZfI@Rh3OQzу@\4fNޔ9IIKLR< .;Sl m^+)mc$g9VcE'4xVȫȀ RFQEq)@6)dGjf̞EZ H@0X(D Uj!U(\P֍O43LBB ˜ZN;XWbp(L4`&i4u4)NI77 1 񚐊a4m!<ӛ0v &O;17M(j`RP 1Cj~;#Hahb+Ҋ(4yp4t::3N;")4Z(B)1K(PQKE&( v(7ӀW)Pi1NpB*LQ(vhN"v(NC#M)Rbrǎ&)h%X4Qp+l=R)SvTo[5F3M3UqX ]&O‹Rњf)1N=zShp) aZiJ4N!sҍqX`JBSsL⛶>c=#ǽ6 \bhJNiRPyӀQI#'pO7(N()4] PHݼSFRxii)Hⓥ)4iE%0LM17s'&j#N)9 H4O*});g4T'iC)qOpJ .zBE;0JM8%YeN)7PTE℀sE74M%P&L\Q`n)inڐ)&-njPRb$fս\b BҬm lTM(Ag5>jvNbpZe.W V<<.+?( J.+a[.K,SJ#ZE! QpRcڥȦ;S ȦMzaLDX!SMR*Ja%0FӊhLfwҗ4WLS1E:RbE:3N&`sKJ,XJm拁_jp.6Ҹb1&(@BzEIm0RO ;o)6nii6Sъn(+OJi\d[h*MhB0AK_m(Zm&.!MSt:9bBiI.G0X']()6*yTWZAZ9a41Rl EaIyt1JEhS.;hRm?e>(#)i 6Gi& 1 1FړPxO4hFh&(f\Q,i Sq@ƓiqJEUm&ژxhIhEbi6e;}l)6;leXF9bJ*(:\sFk;4њ,)4b4n%KHii4H)sQnI5h<њfh42QKQx40ފL0@-%PQ) 9&`.h7P6vi3IELJ`?4f3EM-34 ,"fөlR!Rn\R m0ihRڌ(4PMPqAP!)hP Ng3LQ@ RbG\iP1xO4\▖(QZJLRN@I\RR1 4F(isHi(LHM%1F(i P7(ݢ)2:Z~]\sNRpN)qIu391–Rn)bP1RP!6bښE7RS1&8RPqMi!)3KI`ړ&Fhf4P擵E(r)i K44X P`%hD&h4zP1RNB)Ivq%P%$v3qMiD5q4MњFS"MHW`ol 7ѻ&(\8-LݑIũ7RQ@ OfѺEԔ7SM'4&7S9@i٨iiԛ4P2@iS`FL#֋Ի,Z^=hqJ1QѓE8i2Gj,♸Ѹ+(QL EN\`Fi!is 4bRfz\i2(њajLԇ8sTn-LINQ\cN G(I574XEԹEo4r7T;7aܟp*IPcxAd+x4n4BuAPأ K}.Ml42L҆N(ɢrmnI8敂ǭA- :2) 7Ѻϥ.qE~Fi7Q`$FuMiӰ)p(FLRf4P1f2)E/iwQ`Kwe\n7`%F[nѸP IIZCHM3x.(QG`(j7T>h仨Qo@;a\4i)0RShifLS|zSw^g`e4r)sHHd+ǟn T'9ʃZC0= Q($9-7}Vǽf:"Oz7ubnOޓͪ7Q>bЛPz>QsisUq֏2P1sMq֢= CNMW3AuZ9Bq5[#i߈.Of*54y'pj4ՓF7S3Mf 3E4\*Lqdؿ%\jށ-jc76˦QHdT83.yyKͣr1w}35PGzoM@\2d#Q3<㎴\yMTy1֎@.y֔Hj{f8/eP9hT|M2i9SEfSGsKLz r#N1P߻HZ\٦w֓w9Q jidӸ@z7ZByA;I>P⛚9Er}䞔w=O>Q\SsQN:S|h\z3Ib`MU]u ) dv}xESwR0jnTc&jfܞ\Ѡcݴ`FJPҺ l},GJ@~i3MZ(Iތs@0f)EIIu74q@n&KEZ)(Ȥ u%3M4hI0ig"Jb4fZp/Q`ZP}!^3Iv76A Z@-V}P-oU|zO:AseT3SLjRyu.r)oz搱5,4PNO\ŏ4]n4re=FIG(\ZaH5ڝQ$Y>I&v7< '٩0 INA"n8N*4ݧBBx)OzM4q֎i0sӊ\6:P@rp)x捸@_jQ4i0qրe4,ȢrSs֣ތQ`6%Wvhh|ľni^ TJ(Z9izQaܟqNA>&ڕGJnT)4+Q:UAXO(UFi_ PzSd NC+c'_+sp/>jv})sIYyG5bH0Wv—'({S5wQ\MP='5\^dTiQUM&JnzZo=i \pޟ(sjML2(Y2ZoXM1U.bי)Oz"DY@qU Ȧ+<ъiCPQ|%֓5Nh杂e>s@h\qQFh\vh{M40hZB˜[4֛3@i3ME% GNъF#=hK27 Fj<$Kd '&"YwjbOJO(&꫱YdR>&)j=94;Q7r(8TT-@XTOHsNҋvJT .!iBrAG$tb=I fÜ IiV"8%XPb2{SqVGG0U c6f).ROʐFsүyj;S1KjUHVBRlA ~yRJ줈CiD_?zCJvPn9NJB1KZ_3<ѨM7ɥ2`Ѩh;`PCڋ1=iBsP=.H1\z4 Z Za]޾ED}iC|^fTFI.bߝ(j(AwRWuiRP~4o44LQ2()Q3I1I\2( cu%0RPE&h-Rf3@f&(& )$h)@%7}&v٤M-Ig HZZv *=ԄӰ\(/Pњ,+QTT`.j7y )7Z3u oJ|rB[̣>Q\ZqIǭ'UnG(\|zo4DZ}h UiwQŁ%oVI(\ V=y.O{4`1~)7dTb8q!_7昁0?4sLDdqRϩ&FN;wSj"nkfsTҚM74H٣>{bޗu3$/QѸb.Gp(ߊ,'1MDy` Ҍvi7Td¹6u5K:a&ړBh .}j>sN}(.o>nB}-P FPRh14.p^3Fh>OjP&`Ww*@=+6ZLURqRGӷ{Ԗ#p*p*YVf(1VJ] &Z$E.ԙjqS i&NIbK wrDZ3 nGG)X.?~J7AH:Rn;qN?(Oƕr\ZAM>Q]-@뚋,ipM;H/3QRK 7{TXEMbpX.J\c7GKMEKE\~ޣ(╂{ѻiR,pi=i1KAI,8ޗu!OZ7PXPNiriiNiGz ǵ&SJ PverjR0lt!m!443O@ |Oz4e/8T]@F4j@R\,Ei8q؏e8 R@ Fh(2MRR7i黩W[)7 7a\iL!H_ښ[5Z؈ MݞGZ~3A_;6L q^zяz.#"qN\j*oZA&>aXӶJ,AѴ;`G8-;",P/{R\v";`bw"8JNv7 BG4*3t) 4!X({?i⏵Qi`F/U>IŽYKw{}9s"AdCsK֎FH(ULLn:L=*O8S@ TT;L q=*@RR1`Q<DZ 20*堭+f󎴝$Cbi Rޝ3cv)n3aKZvih&I'"G&4iڗJ ; KxP@ QKFh 3N)9b/$֎4g+JyNQUpHe;x4sJkyt)S+"KjLS4\mE(Z\qJ:S`F:Rmʝjn;|S?AҐ.)ųM0N(.)gP)h *M7TdRbiiGfAO4f+FM&y4dHO4뚫 4&1vS Rt&PdX.:ފv %-%yXR)9sI.)(%s@ZLRPfILu&ihFhAP)3K%0&=s>+VI;+''qPgYO%le^Vl-4!^~[bS cni)mh.1nMMNni6\9&ISEͿJB%&(GM);g/j.#KA=!ɣHTUG&VIA4n*lPlx~j^Tdy4vO(; h Kb EM/b ҕ9bF`-!!;QϥJhXo|} qXo 6R&lKޛ)ا1A)0L8R`fht5!&/;4(1֐ HFhJ7`.P2F.8w&E\SHo:— sLf&M=) .j#'ja=j22( n >PDSwP֐*ẺBX1(s搰~y>As7coLIQ.blyų'0*.rߚ}hEzU.sը4 “fh4 4\f&h%!))PqE:n3Izu%0h AfLRRQ@.8`zLѺ2|C|lt0q$OǭgJ̥D`ڧVo/ZVw$? ¶P\~=4g4& !4RsO &M;mdO&( FQLAGb{P0⓽@b3@ 1KG4`LR{0I(}G9,7eXFM7˥F56RF#1nʗ4Im!5!4\Df1n)fH@iM!""SFF*O*8Dd a\ 4l>\V #ڒ1C5WOZCӊ}(0wB+F44Ь7G79t+2G7wX'7gzUڎdd9-S^y`vt4RyT+5gMڟ2 J捙gI.R^أmZhYJa83ҌJ4Y(5?{ O*0H(4M0IqQRc4Z\zR@I i2K3!`C%023Nr@D`8cNJ_;"(>IJޫ$Se)sUHg.V>dZzMLZ<z9s"KZ <ю]*>G Z7Ҫ /G(A1U ց.{ſ67ު;Qů0暭Ro9>fh/ȣ.ZupzM1oWqqD.YicPnw&[=i7/2(;ѻ`sEj HdUzi |-.TLx>@.@>x93U1֟ ja43y~)r{=&%s,O7W$⫔\C7&Oj,̛gEJ#=(li T 4o> B;Myړ< Hfi4RQH]WϞ>Qo>RGnh%7u%& @ QLCyi7Te',tNZwA)1s@nSbsF)7=bF)<;q{6'QjEf}}= ezҋ~9ѥZ<ϭy94c'=k;>yƏf.sGh39?f旜=i|eO'G3W\ueց)c5|G3ֲ֛6za,l}S aT#XL(Ge O֏fÜ3ނ'A/fFEQ$G#t\Ȥ*0:-O;{br-fZ0ޅȳRuoOz| SsQ^i]4f$=)6g3FKPGn)g4萩444jCl4:Ѽz,i<7斡llw.zA81KM nJiJ=Iǭ4ش#ړmIǭ'\,3h`S_ZL 4!~E4!Qޗ 2)!j\L5)1J}i) M'z`d n;LCQړX.K@jWEsL/}֩j'}&j\AƚWؗѺy֏8S[Uu\ȷQU3?qG#d]=h2 f3Ù| .rG Ru]2̪^x1tQ\-6{ fljvIRɞgy$8>ͦ&@9C$~g]qDcpr Gg}iޫّQIZ7y^^ǭ7^p3 3^pg?d旞=hfy} />8zgI{`xZg=k7ΣًFޓe2ha ?nfyj~=Iwi<ӊ=n:S~Yo!zOiU /Zo}8ia=>}k4hZ=;MϹ0Ѽй>T HA\3o*()s2s/4*iqN3bqϩy4)XM4`FiB3uI7sgj9rMnhHHZ(7qFꈚ2h\uEOqI' 3P4`&iqKErN(*,)w$$nEǖf7QTt rMnXna]nvj>hɢøџza4f Qޣܓu:8.>(杄I).gz( 4dz{Rf=hIFiŢmR}Ků>>WvM e<vO&G"9sHp9T2\>*DCԌK1ܼyx;Gg\Y^/uλLXWkRkXƪj4-nnzC\W^r/5~U`B\ֈM=$JiwjI(sA)e'O\ſ8u~g7̧.bIcSi r9sio&Ps\FQnn`.FQ4X|ěQg3Er`Ի إJrluCތaܛu!ju.OW$FEq074)7Q`RmxZiqEh;o4`Sw=Eqq\S7Ѻ u\2EXJDT[!cNrJL{J$h智}0&x57P;-G 仩7T[֗u+3KQ4䦌{@Iz{xL8+&onNm1ʐ@#ҔFh#VP1"Ksۃv5o}i$=ZȦ^1R*{:;KcwUWmAQWgj2ۍ"v+㸮uc#tJ4Ni6LPѠϭ.)6B KR;(FEӵ·8"w좢b)GG"I$rIJZN_vjvw:Q(0oz\ 0Mi( (QGրcZ` uuE4PQKh1(Ҏ Kǥ P R@h斒Px )M%QڌPE%-%1KI@Qڀb9`S{Q@ ֊){t=hh(SER旚N Qт BEP3k9Hj R184r̤29& e*"i3,&I4X9zq\/ݎzeI=]~Ԁ!OI{ntjmT-Nǧw mI}D]+{.f <3̣:brmZFAB*pø1] 7v?ZL3Lh(TéU(+_LFYY":xMtN.Əl eq1]u&m\zY{)tS @+7WMKЀOץrԟCy r֫j~Tۊ1^#hpMQJZ(uPGz(zgڎP? ;PIKHuSvEu@ ֏ƃER@ IN(h4z MKwhR)J@t4àQKB(PRSPRwRPKIҁQ@Q@ SJ^(\Qފ@QLz((E )OJJ1Eu.%(QKIހ-PQhNLP֎P(J1G4)? \Q@vw A4)ؤ=(vB Lv⒖SPh1@Q@nzQE'4RZC("(v⓵.;ьPIޗ'cKE qIKH:EP <(hҗs!EhNcOj` );R@'zZN)G0 RbsHv3KGJ( J )@ Iw(@xY-%PRy(8EG4PhRP!F7]7/-/уWE̩+3 &t'-Rю4לw G*WcU]=Q>Qt8:RGk}AN*g'nI`)1ӞjZE&SWnv]G"ؤu 92]{V5226*[i~! ܟqȬ%Ro xuL Clqw)*yybѸ(J Ҙ˜$UbfNeJK/+,'Niv*zoJshԜYՇ)IHʏyʰK9 TDM ye\^GTJܵ8]321V_O<5B ̌@:՘=IUslMq>5syOFX3P16ɔzPf &GjJ]KE:B=)qE(JMQҁ))h⁉GZZ(\w`zAb4R(E@ E.);Q@ -QފYU ILsӁ J.JL^PhVf%- 1G4Q@9h1@ hKz8sKHhb (PQK )hb)i;ⓑKGz%`PRR@E h4QJ%);▁րZ%P:Qh(E&(Pt4 1@4P+GzZ; NcրvwE ;Rbw Pc1;-0F)hQڎԾJ?hKz =(wh޴((%)hAEގqI@=)h{Q AAP!(GPEQE-zڀ J^(֊QJ){Q@ڇ7FOj6 jj'P*BIMx&*]4>W&vE;֜M m8ؤzQp3ڝSH)\,6{P &iAvq֓Kz3E8ъ`ɡIdHsYR2HXutJ,n/ew5ͽyU;- ğQV*`l~h^~v)>߉>*J;iMCG`)AϨ-zc̰Rڗ6ԴP1GZZJ1KI@(tfZLP1j)E'z('zZ(-õ'֊ qJZ. !xx 2fu4jF8(2Q0 )i;R%:ZC֖1IEIK-6s@EE'Ҋ1Gj(iOJ))(P(E4Q@s@ EP~QK@ĤEBQKH}((h1KC@04wS"qE%-hP1KGj@ )z@ ֊/jLQڎh1KG&%-}(hh@8 (ȤbbA@(4 (u(4Q@4bE.);PҊ(aEPE@ E-F)@擽Qڎs@j1E(.iQڰ5hdڐ&RfFiRSi gagޜTcژi1E`RS"BfRcw~MRv?čNOjxRc;漙|lQBǬrgpG }j2)Fcj̘|կǥf\C\٩# -KСEW9Ċq]QZLJZ"dbQ@&8P`utJ/jJ(`&(4PQKE! ڊ1Gj)(R@Kғt4QG4b(GjZJ @E0y9zuF=jf $S*OݩR+1T\hJ)JD(VZ1`4KAP1>QJ(QޏƀF((֓Gz((bRP!:QGz^QF(()PQZNi(F(^3E(1J(%wEh=(v.3F( f(- J1KGJC@CGcNRc`Rb'z)E'1;P(L⎂ v%'zu%GJ1@j1NRQKP`QҖ ZC@ _”R N{G%-@ ENQC g(ws@ ޖA@ 4cҗE&2iwNRH-.)>LQKEj} xSi?IJmQM1 L$q֌4wøhf`h&{P+  ZgJ_zNVyc'y/gl*SUk 51xlW-ޜTMG`#Ʈ}ĥ}E_w+TaIK1 (9JS@!)iih;P(QKE%袀R昄ҏtaPh@@R@ E E.9aE-&3@%-%!eTǨfޕ8Z–NHJ)in`}i{v\Q@ Ni{RbPRc;%`-%!u{ޖ/J1G~)A@PNԴQހwBc)hbQRNR@ H)M4c@zqIڗ )R\Pڊ1E LR 1Kފ`EPڒ%b1EPQKI@v94PGPzP1()qG-(;E)ǭ0 J\;P}hKڌ s@!J(/z3ڀR⒖h4Q@z;R撀 @8)hHJ:R> :P:QK'-'ҀAP:ҚLPz -%QKځGj1Q@tԿJ9 (a(^1E%QLQE:RwjZrŘ-|R^h6rvWNQ!|LȧgW{U;/J^g 2Ujk%xei&d\Z֬\쾆";S\WkīCr IER~Rw1@/jOŠ; >b';@(4R;;Es@ϥ 3F=hL1F)c:ъCF-f#f3jyzPue%Oz]hcsZLRR@h#QKI恀ъZJ`E-bbRS4Zb-'j;P⒖@%ZJ;`% CR((1F(K@ EPZZ1@))MBQF2)hR@@=Q@( Kڊ1@ ^bJ;Rڒ z^sGz=RuE"DSj(%-;ъ\P(SiJJJZ1ފ'zu!aސZn=K1@4)P1)GJ:A(J;P0Qڀ (GրGz((44QޖLQKڊJ){Q(vEZ)=qGN1@}(@Ģ(Gz)x((QEZJ)ii1@ ֏/@Pi@hE%(F2i@Ƒ U::ZHU:Zc=Mov_wa&3KEn`f_.' V14AtiavGl*((-sNJZ=BQޖ.QKIEҖ;R ;Qڒ ZJZwbP!81EP֒Pc4R@i)hIiwc=hG'j:UqMXgu#s4ftamǹ/zSH9֗JN Y(zP!(ґGOK;RsH( 4b&(4mqKGzN;ހp)/Z((4ږƀ4wE'JN3N⒀>M|pqO[ 1L/sQE1Em-0h)()bSу@Jh{R\C )M%1jZJ %--%%/z1@!~vZN (E ގԴPQR6oSG-J`'j(=){Pc4(2(vPJCZ(c4cրsJP –IKޓiJ^ԤQ@&1I֗F(;Q)KڋQKLcE.8v(J1Z\bъ\R@'jNih@XL{iq F -QIE04Jh+"/jJ(RJ;R{)QGj(E%-Q֊&=)%I̊?ŭOt0?J=cBk׵!lz-y! 8& ZJT,ֶ=*z8zCKI[ܦi|qTl/`:fu:آqEuF(EbK@ Kފ(4PEs%hbQGzZI/~h4IM)=h AKsEQKE%QGz()cZe57֛ m+*5.ZǷj($z–\.([sE( Ph(9Cg\PQKE&)=Ɠ-GBcZ(bPnV_QB0h*4duECܴv֎Q )? _`RPqF) (7v;QEށKހ( bb1Jh{Ru,'m:( (Rb4R(~)h%-!aE-J s@ P1wBP:Q\b!R@:sGzZ;QqIu%ޖzQE0RPގQ%- Z ;P)~ Oj;ҜP:PQ3E Q(v ;QގRE%!>(4`EX1%.(KE%RI@'Z;RJ=i( )::TF=\:!_J[1G{Wk  qׯj_^=WLӟև>kB È?Z)hDYW\gj+ ƺ.oB^0xQ9ZA)J6A) Q!E/1-v恉(LAޒQH4t斒KJZ);ޖ ޏ–  )A@QHS J -c QKҎzfU!UoB=Q\WDGiQ] vEP!))S(J\Q@ ڊZ( (Gh)izt1q1h=(Ru(RZZ() -*'eFSbsQL.Z@w(>;՝=( E-&(-@8@ZJ1-'|P(I@jN3K;Iޗ( LRSJL{(?J(P{Kޒ ()S(zQF)h)9bNԔQiN)hu斌qHz0^RJ^Q@hъ%)i(P(EN)M&(Pii>1GF(@ KEE@Rw4(1 zޘŠZN(C()2 .(PQKE1=(KIȰJ1G8QF)iNh8RE%R1FihvҚJ V,@kq":Vu+oTeCG^?zpJOm{חLf _߁*u%.= %naZ~ rx]}ALPveM8CWk3O'ǪZxWVb[X(EJ)h#@ ڌQj( Z)((J)hH'z^QIژQE  (@=E0 JZ(+N163ˑS(H>YsPL%D(Qޖ;QAc)hQ@ E-J%(`QKA ZZ1L{wBf9@KA& ' T KQ/pG\TRz[U_QF(Lb ړJ^Ԃ`@Qڀ (&rhS( sE/Z`&)q(Rqix!4w:Qۚ1@%-%-ԇq@ EzPwEKE'֖zRրv((Piݩ)sK(QKڀQK@ hI )H(ȠBQP0Q){POJ)hv%/zN})i()q.3I@ ޖ1`QEh11YMg/hԔsJ)i(KGҊ&81 NԴS1Wt//Ri|n׬먬|,/y~]Rۥ<כLXЬ/# J1)]ctoun6#Td hp}Fk :6lQJh[wQ@XAKIGzRhQϭ 0q{RR@%+ E旵 Kޒޒ.(J(3I@";Q@);PGzZJ`AUS" 8Tps^eOrJDނ=)z+ӹJ0(KiRP- 撖ڀEbE%hQE ()>Bb(уB86*jqPޢGYӌZ+c11E-"D%`QހusGlQEZ(4AJ;1:Q@Qތb\ёQ@Z1(PdfQ@GfQF(ZZ(RRLS)h4_j:R怰b)QF(IKڐP0 (ǽ%I@(4QQ\b8EqKI@iii( 1KE%(旽-&; .(@؜ъZJ`P!PtP#F( (QE^P1E-P LQGzځkxiwxɭ .|Coۏ:k:.ĎY?zG?%x׮k\@w\WLxl~5޻ _ -1Gz^}(EIsojű m{b|n*eͮ3X+J֗jԸunZ)hL (~4QKLV@4P1(/Z;R)R Z)ģ&x3KڀQڀ ;:@(K@\Q@h'z)vxiw Y'i6f* Y}kVm2lOfd[R:ŤҚgvx2ƿJuW E )w Վ)>hqԋ sGz^ԝjɰQKM4 Iޖ`;QږJ1K)F=袐ҐR);hKIhPcތE CSI@4#G[Ń⥨beu856(M/j_\BQKHhڊ(QqQ@ KIޖ ))h@4vCE))qA@-#4֗RQILShiR v4w(ҁ ԃ ;Qށ ?:}(bPhi;RAS:сQEc%'jv}((^i(QGlRBbRPHi 1@!E-'jPE- EbQzVZQ֊Ls@ ^u[(PE/HzP bҎ OP#C(b) %/S1E)=(:PEt$AV?,Vue[f4u:Gj;_zη^I{2kφtYc ֑jv9+Ci{Q:V8Q@ u'CMc5ҳlǗ}*5fF4c -l`R(v8RPP)xI@l.9A1AEQK@ Gj8vBbu€(Q֐ ڎcZ`% )h^5= x,N5x&P>5iB֔TfW7H?<%EY#HQU )e]ꧪ m*nu +u>b --!Sq[3 `g8Ed{$ĢS }k*]O4]BIYܰ ǷhkMOP[K{܂d/3Aך**v}[l1Y@UhBw.zsR\W2E9bgOP8N-nV_&;cq&pi$Ké!,be-[{\eO^*FKC͝9DwjJZN}(PBQ(a(%-;Z(ޓZ;J1F( ^Ԕڊ3E|jzp>Vi:0ǹ7EQ['us0IERGZ(KNQZ1@–()1N擽8Gz7uځڔiČ=Fi>-EZ;QGJJ1Kڊ1F(J:RހfԴwZ(:RwzQKE'j)i?QK@ IڔҞ((9%-P+ Z E2!9/j(Z qIKE0^qI@G4wȣ4wERR@\J)hbRC@'K1@ IGj LRJhF,NRPw@!J)qF()E/j -%-t^ \D7vOaJƿ٥/*[>!9cڽc]8z[>u>еY6?Z]}:9`vCY/USVgߍ/+* inѡE@4V@i:@Z(RQK@ E)b QAQAbQJzځ N)h@KE&  JwP!9hKI@ Wu,cX>rlqzFOL⦬ʄ] [8/[nx-$г+PΟKӭA +WXԵ=>ET#O5CmgyHX}zZfCRQNnQMZ#*TJ~UxUhr6w叠:T/LiGr7"ϸWf5nƔ`()}kTf>Udt' ӣ/j'jV=`%KJ;x~XDTeGG3}V5f%x&ԑdSSu)'Z0(-&)M J)hZO€ (wс@\Nv4P!(R@製 aϡ{_[Vuѭj%>EIJ6)%ʐz)hw`}E@\:wz(Q@-P RS\~zb㸴brzҎE5-j4QKҊwbNRbKOjwRw’֋);p JZ)R⒘z(IiGLLRڒF){RPI)QGHQFh@KGvbbRъ);@ G4 @{iq@ KHA: t>ԝ0iE-%@ ڎإI@%-h( )hEZ ڒ(%-LRJ/jOjZC@(c+7G!f~4kkOy-ku gϥy-k}|k{<1[5ۇNJQEb}ZNU-Lul^A3SQ^-i!6T؜X";0RREY"QihHKIE0 Ju'j=E(JZN(b{QE!i)i;P֊(:3@Қ(E/P!1KEgڊ(F>sQG&Oj<cxZo y3i^/{\c̹U Vϋkq[)m E=TP夤>􆖊97/j(Q6 G}'%f8QwFyY!|=7*? SMg?NxV[{.N]khMIhc88( (EƁhE-lJ)i(i{RP QI@ E-%)1a)iˁS/b?6*j>Y:] /uL))Mr!)i(Ɓ:QE-3E-&)(QKIHW ? ZNib+5%DE KIҊP4R@EV3)qI(J^f%-%aGJu%Rъ%Q@ S@!9 (R@Hi~R:Kސw:)zP? (ih KJ)(Qڀ&)0B)H-  ;QGz(s@&)h{E-Т+!Җ%QE Š?)RR1@ (ws]o׍3\uְ?ݳZ?kG)ZƽSg,Ϛ5 -IOl#xV>-}t4+-'~(Kޖ[tͻ/UU+1>lʊ =dXJ( (4vQ֎)1KA}ihQLGjB)hRRb(OgKۊ'~c(Hh9&:q&w~Pu_^m3]1qz4?L5kWRTa-t_/2c'UWWv$j+<))ԙړ-QޖXQ0޵^)ZM\棖%6ϧCFzYQljR5RIzx oJ-J .(ZVIځ;RSړ`RR(斊JU>ܪON5 EM 3GMHv1Gj){Wp!1@LRGzJ1KގQ@ (1()AIKIFr'S1Rc֣{Ѥc{)i1Z(QE-J-(ĤRДQҎ z)O7Lb撗 RS$JZ(4K֎}ihqKڐĠ(EP .( EZL{PzRBQNڊ.0 sG4SĢcދŠ1E!hڗQw_O\AΨT_s^mo3KlâjRA%,ĦeO6gL0VĽ sF(wvQߊ @AG8ڀQAJ3(PP(QF));џj@)h Kۥvv9qb fEeu7y_&in 7[.+nڜi*x2R[PYR)%"p3]ThG*9 Sc'䯖N1Ke o=k>J,tZc9NoCSv6b}hA Kފ()hE0)`'j(4{0@#uJx֕Q6#YmRֽ;ԴwZ1Jz@&(-EBRQE'ҖQڗ QKE(t n4RCҁX:R/j(1E--b%bRGҀaڊQӑI@ KHii襤QE‰⒗ڎR@zQKފ%u#֊7-- CGjSIB(Q;KEIږY%ږP (E{E%c(wQ1⎴b QE\k+]τI>A\ڇWq^_?צ݇y,6:?'·kX5ׇr KKI[zNP~4RRvHiå'(EQ1F3H5Sva!R@(\qGڊZ(&(P@;QK&=(1KފZJ(#>o?u?Oƴ<Үu[0B&zW_#-`!QsH{g/lgӷF{%)NR֘Gih1;F(! c(ǽPRAh"( w@!ޖPZ*Z6qdVw ԝ~Gbۙ\om hT+gh$dT㎆r cI\txhJV"x9Ҥ7O,^\ľ9)TJMT1NU遢`͆8?Υ5)-'RRގ3TH})9/ E.}()(:QґIPEp{P;-'?tCRWM*EW-%-Rv- ǥQy(QڊaIZ()MJ)h4J9~4t4[:QH z; MRHz0G|R@((v:(=QE J;RHhEuA@ N(AҌRހJ\QGzJ:ґGj8PA@ KEQGZ:Ph k1x-KI@P)i)Ru% (Ww5ƆSp[@ѫ|?f[^iq̭yLÞ:WNs#zKwNj}(p(%-'z1&)i(I^h-֊Z9BQE(ފ(4Q(zLRKQGj@(PQEv(Ha(Q@x ~0?ZoyURob#/XA9߈.!H{b<67@͚K+d$.]t漑=)1)AqNt*JqwEya&hOzj)!85(;U5i "qT{vqڭ"ȹ_V}S˪}!LKIGҀ N)ytsJZ(h4}hhhGwm5/zcW6%'uazQKНbKIbs@NԸE%\ ( J^QF9@Xz1%G1Ya{bEPI-04RR H(@ EP⒗%0 JZ җz(AZ)Z(AE%PZ((QږQG KڗP1(48&( ;Gz()zRPGEQ@ ?((BQZ(נxdcñ:+|:1}6+7L{1ֽ7'Ҽ_}k,HEt W=ïֺ*LRGj9ڊ;PQKE J())b&GZ){Qihu-R(IK@Q1HiEQK@ E-^i{RPIZ>E-x+"KO-s/DV5x9!HX'ۚwg`Hf*}ΫFw+CZ#5e,WU|BQKI[Iޝڐ `%h!(KEOjLR -a(`&(KZ-QKޏ 4wԔAElR;ogJ5F_z< {+ט NZr=_ /2-ukp̂0=iI'8b+߂5]X}nz${WQ6j\P! 2*DE\j5&E() U:Z7.G^҈J+(sZ/G4vbth@&){bMYQJӃ\zw:p9y@}= >f&!@KGjQژ>uIihӻRfGNKE%'/ǨoI)Cb _j? YQҖs99槛Dޫu$(( R4c1ERw~4tR@0F(ڀQڗR4`'襠iяj`u ISHM1GZJZ( NVcE&8ZhKHh Qɤc1Ni)𥣥- EЗom}?;qڽ'K] ?u}x=4zWA^k7ccAъWF>變NzEtr);SBQGCGjJZ(INR`SP! E((HaҎw QE'zZ;Q@Q@!J)qE%.)){QڗPQGz)(@vWfE9tHUoڋ+;`19  )6?:=iM|ƴ6>GZuC9B (+sGj(!3KFhbQKI(KF(=裚(9hECEwAE-% (ZJC`zP(ڔ (< 1ܟk+׎5I^k?&k̩ѥ$Ԏv$U$c1_~ׇVˈw٢خ QKAEi;H,-EM~i;ѸjR⒘Q3E:Q֌Q@ RO(J$,չ,0$=T7F鹜 vTЇú! ]mQ#hJk4z>>5<dfYBy@ֺOsU&8Y&% =)b&L4^eŝyk- ?ZGY*AV笠ՅMȥ6Gode^;')WY%(\P&)ph(GzNRSRPhhI)|uJyY{Ml&=qERkEo?:Uk YO%RT!8(QEhRbҁ ނ;)hPE(F(~4(-Gj\Q@ĤfQށL))ԝQޖ.8R(cP3Fvʰv-R@%(QZNb=&=(KF8 Ey/56viv!\Ӈs! rFkf H^>-^T}+_+A=NzGhNhP(-}i1KF( ֎R@:ފ(qҒLP)y >QހڊwHzPLQږ^u4}(@PEQE'4ӑpp)7d8<Fc[@sY59A[^A?ax?jSۚts6g+_zʳֵuNjHzS+sQ@`J(w-!h JZ;Q@J)hh1EbhvQI@ i)ih 1GA@X%[Z%ʌp@Xɮ@b\_\JjgR0?y_#Х(y|s$-vzTI{6-%- ZR'jJZ:AE/z(;ъ1F &){R Q1 `8EJjkRpwE/XJ~\1Tz tϦnnR\SStſ/+E+,itB+$VHq/(ҺmPQ>?\dƱeA {WC}X nJli"g%}8+KQԽwJΩpqb =!ҖX 2+R,(WvTn?TW F9DKF(PQp%/j;P)qF( bKF)hA&((uRHCiq(1z)hRPRE 8@QEfPP=4%:ӿ J(R!)h9h+Ӎ>1@k`*t:0NKćOyk|NO^tklt1fes#JVASAQ())i(QKI@Q@ NbbBQKI@-'Z((-!Kc=1K֊C1K֖J;E/jJ(€`v2> J4u ɽ=?3[ S}`׉ПZOG1gKZdҖ]4>G~wJSҊ:(PޛޝF8ZJNih@ KER@%Q@j( CKF)v()GJ1F(HĊK^.kW º W9CjF5sיU^L)lV0-K]paE( 9@wIKI@QGK@ E@ ihRR@A5ej]2隒/SU#f>3#T]@z(jxPvߥe&*biO麬܃o,v8ZkgT$eXd#&(Wz-ݑq߱r^f *eyq$E27RU\ĥIGCLBRPE/JC@ ږ)RsKGCHBcҌsKK@c ʧ-Bvkuwc?+;aIklEb B)i ۏWTqaqVjOi!W?Ρ|e;Vf.v>S6GHဨ(NkRq@(@) ;bQ)i3@GjZCH)ݩҁQ@ EE/zLP QiM!bR@HJ;ҚJRLFQY\Gj>R%/z)bQGj>(((1@lP:QG|Pz|S^c̪=Hq 3'ϥy۞Mz'arN+"ct_Ge~tOEoGva[(Nq( JNE.((Q(8Kڊ:PQKhQ@ Ai8bv LRZ:P!1A =ǭڀ KQ=x3Uw}ox0bk|/9Z֬{ZخWsҎQE 9Gzb J:Q (4QF2:Qڀ (h)hPE)M%Q@ GjZ()h4TbD3[`3Rkxd4TrzZ=3;_ Ǚ+IV}FU?+Hp}5 Iq:87zgЧ&MkRV۩ЇŽ)LJ(EQފ(8Rc֘ @%Z)i)9٠bQERҊ\QLJu^]֗\u~?5#f>3{RpqO}p fSwD(5DIڝڊN(sҁJ:Iv_е+ -{k4 m{Gi"KɊèqx]~Sj{:ȿ*RRZOdn7oAAdW25[Ǵg[ݘVRR(`QKHiRsJ)i1KEh(/z bҘb(R1E0Gz9@QE!8Lڎb(PGz(]?ְmՌ Wu?Sb1-@ E-R@ G.(Q(E'4PIKF;:U_/+޺FXb>kG9k})n88?V)&]/Md2ye; V4oURR]R94PQRS%h4t@ `8朤"U$}CZXG*2deRp1Hk YdEhO,wKRKȥ;0;GOGlIj~A= 1emYxASZ9JrLuޖa( ϣSjc&׿٪֧¤mY#E6V1Ynd'Ϋv32ʏTVQӭnH[>gcj$T<(!bK\R EAGZZ(J(ǭ (@Ĥ~qހRE J_j(:QK⋀(P)hB;b4w))h0 @9PQKNhR@t [UuGr-kblZ}kj(a_p[ފ(&(Ebw\bN(Kڒ0Ҏ(4 N( ^P+@E-bQFj֪H1DppT֗_BsH;ޚp*S@ɓq~#xOطJOqڼ3:CejV?5OGO84QVHQF}BQ-P04vq@hP1(QA,!{R)J<Ⱦur/ޏTSkG0&T9`_eGYWGсKފ9D(BQ֖GJ(0h:`QGz(@P uxa>pV",Gy՗9(|3_/clN >ѓÏuUWIBt֗i\ͫ1ON)8-n"qMeo~陈??@z:o6𘢖+s;ՋsN#s* f`0*S-5sOdRJcuLr}yP-#hhH ;qZkmfk>zLRެBZBt))hVԝ@4 v 1AZ1LBb;Pz0IiԝQqQϭ J(4(A)i;PGJ(4b(RLPgWWywZMLQ]vq>$uPN܆➻okcO{du[ݘ޷9R֎h1F)i3@LQKIր/Z(RRP E/jNvPҊ(vK@ EGz>PE NRLQKIJ.QڝIEAE-x? ?*k˧ֺOܟYoƃC\2#;a𣓲i8;3Uں(aYj'j(#Z"QF=QpQpBf;4E-%AQRQގԸbRwb)h@bS;Q-&9G\}2JUɏ gS> )h3;O JERql3K"?ju} c% :>8`TEnG3GT\8$bO,w'@sXjtdXR+XaMHFj|}-oo.y<²@sI2RERѳDÊNƛz8$iHRA99l(Jbӊ}G oI(OAjKM:-( I"vL mϖ3pQ&LeQJi-O+#F /j)TR~.j*f2Vj[KTWKړQ!EPQI@(<@%!Q@ ҒI(sF((-6\Rih4Z)}R!Ƴi]ww}ҸM?h+~Lj? &Žv^(q֡lhF:Q#W.>u1 Cޖ5@K֏Ƙ ׊)i1@Qh((.(%bjZC1E-% (-GZZJ(R⒀BQJZ((/j6q9]_Ó~!\~Zgl~rV·ۋbmģc1I֝ғ1KHCi{RPQߥ- J:Rь!(b NbSIT!i)sE!EP)M&(@-^'JNyTjqQS:1KގU3;O p3_+69]߅Ø笧? 6vDV՜sUtMze?>&QIJj@h ('j;sKQZJ0ih%u%&{R֊++PTz7+n<L җs)`ɪ֟oſϷ+:;VIJ)hAE-()M&(Q1:R)i1@ ތR%4 ;K^<u:LkѬP@}^/O~?)zhFPS$aiiv ajJod+EyB5c@etiYWMi/-ʧ_TuJwIck Hx %ՙ~`pF e(*e^N'H*Yx`Tx9Zҟ&d8警N=Z}*,nFO*e%a;[ieQS G̲-#BE*m8!duVUrcxWE]v1QGzw@1GjZ1@ Gz(( AKҎ J^P)h;Pws@ĠQF)JSJ)1@vAr =8^QsLdQ>w%ev}d?W 7ҽß/Ҽ'&3? !7wR?ݿޫOG%O"ZQڀ Rvv ъ1LQZ(%-Q\;R@ ]O^1=ko?e[f#q#U*{/Wb}6_즳oތQJkqEpQ\.RRpQpihhμBGӁ>\+`1?S\qgoTQKڻ:BVc`r{楠MgjEdp" /[V\U7g!ܕ߱jv7%1NNKݩssP!M2=Fi4$AL/%}<u,FюG_A}G6>a.e (n8bI57)TnukYVn2|aѳW0W` RO|rz֝[Ѓwc^I`k@OE}{VAOfֵ6=f}i;@9ZcIzR>8#}'TZW(4S}Ą=ivCI1GJ/ԞGB꿽Y sUuֈ kQihJE;R{:KފJ. ;E(R b)xPQޗVFKEa8.(VZS@I^bB-)hZCL,ihYڵ~Kkxmx++GM-ĝ'#[4滰k%$6_=@1!G@=*л2!ֺOL}ZtR2u&)E.kch4PQKF3@ E)-'Z:E%4w KE }(Nb SДE L^Rb(@zG=MLRRSI@zR◽@X6ho\޻¸7{;% HOtj/V+t\f91EG“KEa b(@i1N> J:SIހjR=Qڎq IޔPIޖ(*Zcүti]JmGv_hKwҼjOG+ϼT5oq}v_KR:U +Lև Q{z CZG-=hbc)i`z uaEPIޖ`%-XNx4] ZG^ko}+:44@k:=G֗HzYT5E/%w6\QAҏ:KGjLRE%-uK?Idvg8Dc^qW=M*(ÌJVRuI zWU.<'nxruz%{ĵ~N&&6՞R=[)&u~&k\nԓ 쟁޵,.{{e1E=.zٚZ4y-ڰI&A]fhF}tHWf+]S] 7UnbAu>DK+"p7reyEX)ddM7착; 6B ȥY_p UNZNIcc 2~^xa5&k>`p+*O jx6 b֬R¦:Q;@Î1Wn<'0@I,E$*uihx~;ID0TXiޚ[0#CI94&GQpbP =x ); (XoZ)SVFwQE)( (Q@-u ?nJo>W }O5֮ZK'>uxj~5ľ6uJ/𮟑\DyOf{E>5VQKGz!JJu ;QE/z)QKފQޖJ(I@Q$ъJ)sE4UIL=*r@pOҦ{Ѳ߭FV;}|Y!2A^ȸv>_;b;#*80ִ1YG>y SF(;P F(9E){P1ԘJ9Z4kp?l?+|zyCu~kOG?oO7o_dgެnj%;R+/Z(w G4v(4QEP(SQF)q@A ^pONע)vB禬\ik5(WY&/4w#> /\u ~汭ڏS? TijiOb*E)h?th=Q*U=AXI_@֒6]̘hZM^h|ʸAmAʸ~/'+f4l[t-5>=voH<~!R](RݳjANjn1f\q7$cvZhq܌T+aSy05iN;jw6wnrhGſ\~ Z H`;*Ld YBjNS$U++5yu8ԑP]K{k5˓2==j属0`<Xkq>|}kb-ݒ7kVΏ4q5Ҫ1I7,m3H[X.47i>Ӊ`;xqVtcJ\s&KC(c?A޻m#Bb1C'\I,KQz ֕D3dL?vTG_ң"3kAKڐQB41{RM!LHZJZZ'j)ih%a(-QIEhRREfXb PwEb-zKA(AH */>W' @zut-oޞǟxֹ7W[LFy&9*Qd#޺H}c[1(((q@(( E-% ()( E/zWSh--P ;@'z(LQڝIvRb@ĥtO'?Wo=\7S_:&W]HW*FOq]P(=ٕMQ֗ir9}ޖ)w(9ERa(bS( )hQKڎ( s8fPim=g1pUӏ콼nݒ;M苇R~)Ew;Ⱥ5ycA3,T'ڸ:ȩsVehv_µ]4%t n)hF1QHbRފ`%R_b)P)h,%t$]d?s]+<ۼ1*47ҿIaN1 gOtk?E]0RSRPbsKF9\QPQK( E9HZJZZE-;nӌo+ug7n'tOΥT}hL}(.(,+F3*k\6/hk &-үT4LUj ~ ҭ_[褟| ϭZ-s4IN:3qq{p= uWdϠƌp1M%Fk B02)? G[=2[2RInYB : ˇnƺۉp&)% p?:ɻ|wNLĎPVӤ 䲷RfLÊJ&Do:jI]ݾ$ 1~L F( 4Ҕ]˜ZhU;D U'gԯ頑c\ g*{+@ }j޼{gȓHvfJ#-6*܅=jD>V_H| AqQ 9F6#&ަ}%OwD3CŨ u Ժ}Ik$U!]YJ$JQbi60[8ނ+_Sc ~aqYHU(6>`G59'b*B^CO "X{h:)B1Z]m,:\ӀqSzR@&(KGzNsE-%qE0b(,_G/5bRw,%QILb KE)8 RRE𥢁i_9J;`-ut'S^ +g/>J XrWW?Ozd u띫Eu}+zf5bғldRQE.(8R@ :R(c)hZLPE-%w;Q@&)Ԃb9ޖ!PxCiiqE%Q@%-P:w)_O\/⻽0-1k|GWC_Ղ:uQ?.}EuF0@#؊SS7:8¤=0EjHVjXx\BlIݍ$ D-BRc\R‰1K7c\Q@ ) LP&(gnZZW(0cڝސ}߅bU͋[Ȕ0~Bԣz=){Րv>ٛמ'R~Q!U:ZWxEyN5qIJ)k ړ-`]n~!8*itTB,>-mָ#inl?θ?qqVm浏Iʡjqhøqyt2F߆ ׶r:.Weꞥɮ\c/Fľ#zsȪ"qVNt~"޴g/>4oXkcc TQغ&^6 zH ']>Ú_ק*eQXo #>d%sWBt٨G\+GR!!tU̲ɨOlM0~T}X9&RbD%:J QF( ǯJw#\|؊ؙVNq^W{Wd8#.1J%%{vE?+[iլm>xycLT&pI9?4^"K5bZdFA,ښh_W(#1d\#U(PXI aȻRsQYdSqODaJ{y\u ls( 7O=qM yX97T,u;\p/`ʺ߸ivgZYё`+9iWq$s^!^e5^H.'?P69;cj& &`2?W]T FQ`8ztt;i)1z :I`H쬻NTMifVkTFmgaTʙ1Tyj)(rAsqU}&7*ݨFVQL/AV/I-:D|ve-:S2Nx99\ ETTҺ`I玴 b/JHi֥/3DÀx>19a.Qڤ c"ȃkIbba1z(Hau8j=q0)hw`րOHڟpS3'4;vs=/g.:G~i6 Ժо{9[brxtZγI1RQV\ v*XzK 0R:)"V/e.mċsN&Pc8>IZb)ɴR%e\OSl=i7 'Z+ewPK`+EV/%4?yySnwmkE 7IGs_ݗs`΅cF?[5YK]H֯ tSjgNNZ"]Pj_(4 #\2qAqMԏp3F*VsiBZ^6ӗa{ӊ'9a(JpŽx.N7## C ]UrQKsSܥ 4F͂sImmN RqJZXLQhn8 i B\2`w?M CiI'EY' axsX7~/7cd{pnk8 ;Ԟ[g2$dλ#hu򰏒jUX(\nhuS J,W}i$O,fPٲRl$ wLʝ֩b L^]%2Ro})VT.X6.8†41HYXBVD8`揬SRSݑy4eGZ~ĩ>6~F'y?s>;zu,OS$dsHݻ /b-WIA4gJ WJ75%.9=h8^M7R+rK]ذ?!pJfn_?Z¥XfЧ$LY!:cDoW⶧8gRm/zW]n']ƒ+z=PW!?ˮN?5aw2n#^ yof|&8,}\T88K.3ki57<-׃?/\ģ1ƺO 7 "ِp=.'U0OjCg O&(a%c6ѱCYV.>Q[1u`*]DE!I֬c meeLDjpSFsH?&ʂ|}+C(#"C?ڮoҷib(e]Jx1Һ]/MԔJ)W7>ZiLMTp%#QjG7I+_RK!bae sVLjImL$!¢vV4?ޱJ մҮ[aiDqId(SSGsx;TKlay E8 }+^cJpMQ{%07Q|q<2i 5vKu˷ ϫ$9<`+xZ:OP=(]9cMl8Qt+1Su$;1(=(t+2`H dKn~QCZH(*} g"M$!$0QБcgMAwR+Q42H$~5!`HzPXW\VFܫd~5*+Cs9^AZ""pҺi ZKh\ob:zz֤~ Zr:{WCV;Hx pSZˊB'$,€~Qbv$RG= AdU`-ؠkuv0A}hRLXM0&ܠqJJ#3}jxbH ~*X vfc;eQ>RwIeչ@,d񏑿Ɓe&?26fS/*񼑃ZPB0cc9E$4q*zٖ( :YHR;%npۓ0;i^!&I* nAc: 4Ep %C`K4' A`Gݭ8,]ZЂGq'ܑ{EnW9ewʓk"@ʇ-BkVIRmʱI=!cnbّ,[pFC#0TKMn74|eAO\lʡnN0~?Q^7b+ZL$V\C=nPvcYA- ɑfXϡxC"|aKzkqX@UFj/qQW֞02QL%VBHgՏI.2@1O9szjњ8L;V1ިƳ[G6,+һkqXd)2[$c> ,cπ1*NWզ;[f9y#ܫ"Sy\py-9*SY%W])eK9e;+zh eqҢY 0efM^?3ve8={=hYNvaj'q#ޫjivJ.Fx?Z9 &:i@CZX_,d_ Wby{>dO F6PJMO<)"|2^2A+Yr*m #<)V|m~F2)0IyW,/iQBHchUG# 1Wgh\phdcd` ҟ3H8R28'Vspd|fKބC(XRГ+ Ѹ`20z-_T>sjFFdfA6*QNNԓ$! T1'8p2^&S)AeS CLI}G\GRH=ǭ6D|?+gh{|=$iϠiduE}v9))6dUT-H b21 c9""C(]Z啇E)VpLds9pj<Nۏ lPM5RV9Q !MU9,~SA.Bmʹ*iIqr"ܻIOCS1gw$  q ={Y*!y<RE<$1.㷽Y.m7Gv˸Q]1|BҎ|*K2ʌ_^zQ}7$/M9\&O_zkqP.Eo*M9c*qV!a`]lE ΎySar@|NAH-DNW=CD20T[Yps֒U#Қ \W#B?CA8_UfcEXG "F` E\F*!lRPFTqr 4Q8Fx ǸygCu8EWb@8~jwDM+F+S4QjѦO\Fdf"O${X. py>*Dkߟj!,Sqڟ*_pC)҇*8*8xLu8 5%sBa 1ϥT@T`A;X ǁIbj.$09Ñ _ d埂qNH x=A-9R{kW{4%;.Y[E:g&H)ڋ.0=]||¦X݂RyL a@ F۵@yN[RD,@Rն +!X=7򨺸{qM fLG\ht۵g@$>B8z.F);Ku7:zT1Ā#1o`rTryY[o*R`֚f8<<#r=GұI|mPHa"pK)PݾJ9EbG_z[a6-ys@2ѕ^O[v2ѫcjӈev?CcƄ&nd0yݹw߂|zZk v"+mgfRLlHcU] 2)>Ͳv ^e١~c3̬ÕU[$ϘFYxGcC_$A(;]{هZw×R>T !jJFь~\PoE<3JL?7U#$;7Ƞ:@zu T$%%devT2KYln$JK:drJvfuN2 ʇpqM"HU`S݁Oy*w (!瓞7`;, G&s"M&)Yȫrc8gR:{uâ^gֹ剣Jmm^'[;4Iv[bEo,<7?ƣ#)9*lfA(iA*<ڎǬ#cڌs?>jIEMcZ_giBzwj fTuHMX^@xՋ_%hQ3ƒPkXua2%w`7eVQ4ƮlA( 9AykmޥrF:ʨG"ۤfՉ#8,k 9)[{lCo%Oc ;O{<]_H?JI멖noMAqnl)@yB^hBidutf^OJuن݇ ЉȐwd?ΙrrA݅ "[\ۂU؃U8&T.OJ6nսjϙ𬥇j4A""VجEl5oypF mkVͪO! Fw^E-G$e.ooOkHnT$] {Is+u yjŵn loTmc@ VqH(O]JNAr7㞇Ay$.Cwc׭;mqW@0vی;Ud}@#'JѹI9`׮@>EiqR@jdV't5gL_#>ROp}T{ug$ ̠*ĈVO\{qҟKR7&΃;PhA-q2=\0!2!3'Ee![%YDxz^viO(7b6y~Q s:0=¸Bw>OC)-0DwR̂1d_c5yn2#48UL akzw+֊mbYK.0sXiؠK8e\})s0.4v*zj[I֪Gq | b% `F>;C#Ylcn\=*W,A >B 2)jI8Tټ0,,4d ͞#@2?W'%fy$/:MЌuGsh#@=ғCUdB_#jkYfrxj[D̜pRarF0*eq_XGH`nLnqYחBƊNB=CZ]N%3@) ,v)3ʰ@F_,HTĈX\t2U_l*HdžS$q'qsjk Հ;]N6aU-Kk2"Ikn#gT9 m8ci&كj6Fv7V֫,6 M̽sK>kKnpONzsQ$nozQڙ T%ړ@0T7}=i쏕Iv?N xr*ǜ'd,!&m疘I7x`iRPA1Xݛ(dOrx.ZYWz6N1>]9hh<_{>d>v*#;A{FCUK@<6Pjcdm4N{vGQ֪= !Gg&ĤiHט\rmZPUsN|n?_ZV?[;qff+G"#DvӺ(…@8{2Q`ao v [v+~bF$U'i[޳#5,/қs'>mB Nj"U\#[dve1 A1>b.v9]7FjɅR~5a»mYUW4H$4* ggbivCSenF{{STGv9;{.3Ȍ#S"(/ Z2N2:QUB e-4LA ܊9ĤH۬Y~V^umZI2(a?JX/oV@ܟdMӞF&( $p\*\zgUrBAl6TzRs0Q?7+aB@$CR٠xD8^Ust4M VR[ygv*x@Gȭ#hSǿT0JA8]5D"T犠' In4 1}jMX"s欀#8RJQy)'!cv-=A%QsGE4$,;oBAK^v*'~*FUm:Z \t WKeu@P1\)NwNbڌG I`(H-Ժmx~fGs G1xї5p_Nc Y#ձU[Aݤ =Q^9XyNW[;sM8?ZxHL3)RIT2Pik`jƳm(Gf鎫~qso{YnG^}*dA>?֭4aa:|gb<{hhe[3F3"׵-ۗO' $W*tE{w-%ۿ'J}BĔ&%fcӡUymR&[s3ޠo!S\z%2n]I84l+$/6 >`UgjhbCg T[B̎FH|@d ût9 G;e~@atx/LRVpzԚ) AFw0S*Ao!%%0\Z4ݍ.VXWnǘziҴ2pwOqYҭb ʁ;\-R|4E[\$N,~d9W ,dyx`z |^l0,7p­GwmmJ 鞔I % y܆뜏p7mO xVu }Z^JLT#oOPeJȒ0T#(d!ĭ#GUc鎜T\ޥq.=O=?,Qmt w(Y-Ƥ9? oitjKN}Apg[;Xe#>ƫJ"e{*3r;h*WD{V`[ys[a&5WpF{VL.NcA(kJ"r%bʌq%Ƭ1Itݼ)C^GAeB)nO9άn=|ȫ+i}nJޟ} 4D5 J$(t<A (xm/q֪¶E,˳uLs~cW/P,Yc;aMpFtȝZ] $|O}H6<)fgxx;@zӭ$%qZv5i♌HYXt=3WR;Cv#(IxPՕI ]$S26"mg;Xbd/8ֶ,.I.c0λw[Ŗ%JۆCCs֬Dʰ1e`ۏJWu:{[0C@zzҡ\"q>&Ya| PrZ.N#X FCAd8K2@:pj&Ч߷E<طxfO\:=7RJ\:=RBfŹ7˂цFGV[pd+"x3!2p5z\$[az١+h6"l2u9Dl1n?wqAr{wBd@lp Ry`޼dttЊY^kP 50.ojVRdep?ơ6K!˖ "czPXS6 w?ӧW02SD; Bb.cs*?cbଊ@ z8U. 8A@0x9ϸq., r-d- jmq\ED\FI9FFsd2HJ{⧊{@3D]v98]'͌rrE5;"*s<}3έE<P1Q%ɀXs ]LҬaGo%{ؖAkp&˝YrE-I?).zQZ *Mm)L~ xGT}!v%.a" }›t66"@u-x1L'viC,Q*A#C0l7Gw 9Rr#XFr=wti<b8[(@)a%H3<WZ.P& |zU`!Â2~lzL8%e?m $mcՉm.?VV{SE0 8 koez*W"8!nv>1LcyD69)62C#˘A8ʯ1@DهKpvϒGI_j$ڌTE ΧPkCO#ݑ6 jy)$TE2Fjm}EKo/_Q#"!$+\~Y?;;h>TZX8G O~*LLf\7铜z%&VF)qq"=ya$hU^$sn|70Fn_- űI#)Ijz"32>R8#[Ql5]dlK3ҠReex ~?>Y^%Y\!;^6pzUE1B{&###geHߊ3G<1M1`ۆVRDʕ &W 0}ƈ1,+=F=+BќDx`FFG~99]ݽ Ryu&q$jn#cP\GNb dPLm:,7 p&zp 4|P Q!9UvV{c/N%s3WmZF;-PDHS"O"1T>]K$>*Ǩ?[j&MKA#ADv;*LĒ njxA.6y ڳDEtmx y>?;&])`I W/iLb + e<E-^D%YʞjX_AHVYMO+Bf1!y`xߵ6-_! 0zT6Fm}E6{xZ΍q(%)nԭ *Mбm#׭Y]N vef}#rz8KA'G䑉#P~a}~.Fgjȸp5",/) c;qQ=Wn@` 9"H+dmq{U7,s'!Hnn b1Ƣu!6\vSğa qĎ =1m2qn YHPF#R 8?_´-@^apG럹m1߭$vGjcqA1RM$AO?{Um+ 086wB0D{b\푱2;Ugo.Ko=)[K8qȩ"qt$ס]B]e<3u¤wB,z;kUp)"Xm؛$BOSx1az{+bp<<=|>l, mfh]Dʧ^s6M@n56  PzU/Y E ˭²o#(2["ZFop^?jmΡ$K,$D7%b[D=(LH9%OcEAH`.7gjͳ#rL)G `xǡ$Vx䐪1/"0 d퐎)#91 rNc,Jf(pLReAJ͈SGA(Fk8C?9g.=#tJmo1TJ9zd<$LvNzCmYe{i늮KY 8#yM@U=U6ۘdWv})(+ِ$#8hQ<{zQIŶ+QJ"o`2Ij݋*A19Զf ^ݺ\:uo`Èt~Fp KXoPsC&߼GcԖ^lWH#ydrNiڡTۥ %tRz;l,[q?,,sAmеrc̦c2]ur*]CE+4g?5#Fgg2~`4MVlJUbs=*itZ94o6줞ú3²J;GqKi5k4N)zH"“ZNZhZZ2-B7D8$<~75(z](9u0<qSF՛Q^w+CڟRHDG $4d zyEP^Cuyݽ>U4Ms].0'~y\cT˱WE; #K并GWPÐFG4Yeit`Vq\~ۯjI2~VX[օNW.>sլqáR7wyJ#14#OΪã됝ްLn9W6k]-*|FKg8=:S>dC )mVC^9'ImvuNYNz/|4_]a|ǵ'JOA/ɸ:0z"WlfFpҤm vÂsiBY#tz{wɢ4e x3+Uw#yݓnvU58ReNUJ2ҪiѤZm!D" /g4*x:}y@ٜ??֥]3Y}*p\[ ]՘DFr 8 Xb1sR٣Mc/Uִf5vۥ$0g_i/ޕ3mӞW`G0P$t95^\mbf@3\Uuh|9 C=zf&'Mf%m܂3ڒ%\u~r"1;%HnCc⤹S ε}TA.lpݶ[v7V5;΋KQ`b2=)tEIq%dwcMIv\o]],Z]Oқw-2J4#fVd>T㑌t}fE|F%OH\}qRD;` p6JsCi:SA$z6[09=Uuxehѵrq gҗ)I!X23zv53WdS8NByLgh\.pw׷P6xۈ#rqӚ v >2D888p[KKۿ~0ڕJg8ӥK.kB ]R&>pTUyE#@b>jͦWWQBt˅  'hu&|iׂ1d@r~VwO1+ʈ`?J&Ym=z]T'caq& n?.A=x5֏>iweq 둊g.)Ĺ`Cyhg 1OÚُDwLH Cqj >]*$n7#%}]Jnsdž.[~BgzRnF?\C ˦ރm n@۞Cy4%u7N]#=ehݭ0HPÐG5,nwDyac!27nƒћ>.4=J{i]7[IA4LY)mсW!#tj՘M||?5j׭p&~k0U-/E- iw<,<{U{&Qb&k9 :1#J̒SāRW#v?,gyK%wral${y|=yKo.zΟ^?jU)vq*uF&VwdTV/z8|i1UK-XI4¨w`۞ 8{bM(O5]I)b0z=+Z-#V[vhr%éE2-SIf:G'bo…JVWM:Q\N?Ʃq,7 *n+:Vҵ/>}.i$Z}ڴ|n9vsrX.7獡RX<ĕ1{g5vm Vhec^+yPsOy"& g.IvmFX(/ #<ޟʛp -C`rjsjw6:e /l#=|9C>g|{ڳD$&-V&FSbjFY^~⤟Dbh/$2Ds9ҮˠjN$Y^wv~KWV#HʘaO"D_J.I+CrsO:rNMv8){9.MbR Hf1,98=?_m#W)2̎Y۱?<*跞v@{rk`rOQfvqAWo6u1= I.b *2BFryV5n2 HT)RDWko< ̊PqYퟳHgXI뜯i y]ʩR䊚uO u%=mlȬ6 qޟ`rLU/_}¤2!8'?QR8WOH]Eaaxc۷jg$%[v]?̌zQ3&?,LaCZˤjjV]^Q&]8XwNOWOsHvErbWkェ*{9HGRv4m:3׫U7ӮJ X[zsLZ3:VbuH.CcqPhS u"R!b@1qC.d"HfDRQ {qڋfYYqK)xPHӮJnMۊ[*/am'CsIR[2S pH\唜a֢{qkx޹ӂ{[/js]J>:g֫Mjлgw,oqxO&8&:R+p[NhϜtͻ@!*^=]ؑߞ:QdC*#q#Xq -G=*ܚ0RPFaol-Mr-~*r脚-Nb6̮$DBUL̎=Gz}T2XL:b4sFm#y ߊ=1T4s4XېU<4]\:t/k6~ja+pIӮD-){9љ tH<6?inbWQQG'!z,N1䍢J[#S٤eِ=:9:L_i$h< )QTĤ í>MWi w^7.QٹIOueVCn8Ca횑GjGFs۷^j-?Q.QvӚ)#*k\`Py銗M@U}RROeG8M&:Wg+lO20a$$Fc\ՓP\mUˆtۋ@wPZzaOeJ5n9'|erc_ U Ry.zw. vcn[5)M]JG"w\y$}sLIWEEulҥ5[Rts>vTK֚9w|{P4Z颬FF0?ҋGOi׎?10ۭ:u/7G endstream endobj 1 0 obj <>/MediaBox[0 0 595.2 842.4]/Parent 958 0 R/Resources<>/Font<>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI]>>/Rotate 0/StructParents 0/Tabs/S/Type/Page>> endobj 2 0 obj <>stream x[[o6~7Gie*( 4Io[ea(&ND?^$KIu$>#!=}P^/. uQ,./З|}u:_N/7Eq^MgO ]~Z>zNN?Q"G)9O$ =,~Ad>Mb$V-SQF ey`wͻYnC1!(MJwwїc,DtO2U_zQOKxn1P1`b K,YLqOc"4ZۘG+SnS}3׺HgB,=ѥ|]7Oq.y}b_t/uP“py˟"!-5[GV]uOVF2v 9?ESb}痖uqL(b8}#=y=&;D#e M/@~8Cbuj$>n(<+)51Zm_6p1Sk-h1'NZcQl"$nD>uh@Q$> bEbN>\}ştSiO,KR/3f@@Z^HB;^Oy<~|8i"4uA /yF--b26c,UcN[jll m!l5Ỉ-46W @ ^E0@@W%= ̖RJQt#wV^ 9zEr݀3vNwXdimzte`Ϡv*FT8Aqn~GbgA.J( |TES}Ϝwrt%%RlsX5r*A)I{B՞"ПBЉ&l0ӳL&rfpS; endstream endobj 3 0 obj <>stream x}|TU9N$32$d&LC% i`BMHEQ EE׶b Xւ7p]WW|ϹڮMyrO}ɏ㌱D|XuٔQ#>i͌X򒲩yl31xyҫ*bw_ĘwDYy2ݸ& 8astS2 FL |10K&L#A[յ jZ.yͿ }PջƮ1 - ־bljb5K[X:mool>m<1M5u=;? ;S#}ҙM ZWmCm1"Fzv-1|fmΆB+L#߲u_E-j)pOUɾZL-`}ZԢ{5ǟ]~fԢE-jQZԢEEΌZԢE-jQZԢE-jQ6mE-jQZԢE-jQZԢE-jQZԢE-jQZԢE-jQZԢE-jQZԢK jFvL"bYw6ձ%lKZ7&.'W~ w^UɆ=;)~_@^ S-,Ѥ7~L{+)?w?ە;+0}٭K,nYpA)556͝3{ӫ*SL4qqcnj5rDEyYi@񰓆\T8h`A^9YWncLF^*.UT{C!]o\Qs:䅫2!oV{|J6P2@%GJrw([-y;I|U~MӴ.[K"rWS7ī塊Mehb.֛s{ta\JNbcCjVyM]h2wFFcZ[!CiȨ'v~~ͭ[|u53+Cj *B,s. >WVؘGC, C}?=S0!Lfzed`sMuY _RE. 6sz/C,Uyu{y+6כ}gސ]=IpM}mje(PoTc4L ZB *W)ZHPBiUFjDeAіoR6koG׽mgUR,Jvy{e]CSlV3B*L_JОN(- LJŭVՂ[_Pdر\ZRhPo%w3Y OvPJG,UT-Ψ .#}gLǴeH9?5*-:[^_vLkT`OEEa9RfY8)hFsUtyClWa&VwߘI+Վ쒩ǥ(R!lPJ+nZz>yB(jo`j }yU *_hߗ!ۻĬSKqV+|5>[^6#ho)nsUR9ԭu~r*x6ZVLsLag{ʰ•꒪LU2м HxEB4 V޽#XZ3g>j;Aڃv(' K3JDJc9;"[" S &`UbLpى1mX@5w'o wh-MlCIk;CEch#Nfeh_Da؅&!Oʽubjjу%b⛇o )a2KB_ 1 o-n{'95U4Z{UL`ze(Ə>k4ʍ{DF+E]c֨*K ŠH (Q jj|*TWW{ M}xP^U{|pYŠolJ%yHaU4IF+z^CVmezYGek0#L KͲĚC1} 1Gek x=dAHF{*>"&V"tNk-Uշ+M"Z"m&Q܊yGHwj1!~b1TV~#4ßt7Vsbv/S֜JVx+ņ\*};~}x(Y8>޺*Q ]Ų,ď)$^Z!2#)ZPɦ# \C{e;Ԍ){>U!PE:r,ġiVfGZ[ȓB 5syАNm[)Ti{pOՈWDU]lqJ;dċޗ7HHD }G]0w{= F8v﫩WqV>z!>ڏpǷ{gˮVWx#yq#I%RUh dtDo;fzE~*lZE&W&"yb?$"S O^)*GazUnQRVFG?JTujh:nOrPOQTg̣<wX& *o_W_~aC )o|`*QuMˀ8>g ʣ Z=>"g^1.> N38C6)NbkX-iRT)VJBR,UR,EER,bR"|)I$E RKQ'EsZ9R̖b3!t)d)IbS,$)&J1ARbc-()FJ1B )ʥ(T)KXaR$P)H1X") $@) ȗb'E_)#EKKRHCl)Ȕ'Ew)2J"]4)RpK"E.)H)Eݤ!] qRJa"Y)LR0HB'*"EQR);))/R|%ŗR|!R|&~)>),R|$şP?J})IWxWwx[xS7x]פxUWxYxQx^#ųR<#R<%xR'x\Ǥ-xTG%R<$ŃR< RbR'ŽR#v)ICwKqwJq[]JqJq7KqF)nbKqJYkZMR\%ŕR\!R\&ťR\"R\$ŅR\ F)Η<)ڥ8Ws z)ΖB^{py嵇k.=\^{py嵇k.=\^{%R.?\py.?\py.?\py.?\pyk.=\vpym.o;\vx6!:<3ӝ3)uF8}0R [Ak(4UDӆVJA+-VJ-%ZBP "TdQ3)r|yDMDD 2P=jU!MfQj& DUDD'M# M%B4hD D%C4:E42 ATvcAeDD%70R!DzQ! DX>j?Q?XQKԛOԋ'QQj:($u3TCNFJ&J %)@IDt%Q(>>ѻ|mޤ"oPuI'^ 'MB29_"zsD{,3DO=EE~O$9 z1DR]DSCDv ꤒQ^{m 'DwItVÉmDR-D7Dn Bt=5vr-fʻjMDWQ+)uDQޥ%DSED]@|*yډ%:htv9tѺt&agv"΁DkjwѪt*U_Ih92V%-RDD'Gg TJ%!&C4=z6h z:5]E$:;VM!L4)M ''L'=>4. KE'^GQj$rVւ @eA6PI84(@TL4,;?RCÎ*aEDaР40*|aGoP*/vGԇz^D=DDYaL"̠ٝƼԊ(RY W>%9SUFGKd*i&g Hdz*#Jq"zAޟa\qM? ~xxoooǞy-U+͞c=//B<<A=4Sп~2vyc<6zvޣ#@k>.<`]ߺԳt/p#o|aw[NeYӲsegevm-͖\M7 -Slήlf):o)+N Ta*+VM #:qj(bV,}+j8կ}#Uŗ_xV2-?kT 4g)U:[_~ޥu@p:XNV+r` ,-"`!hN&h: `60 U@%p20 S)d`0c1h`0T@P ÁP NC@P @>0y@  ^@O dY@&@  pI@"n@< b+`@ `]Tcu>~8?_>>>>|>      <<~< <<<~< <v;N>^`; @    p#p \\ l........69`=p6q9?8sq9?8sq9?_ p8bG 1#p8bG 1#p8bG 1#p8bG 1sq9>8gs}q9/VKwWnlc.f\sf3ƌ1vbd"ϖ6|g٥aAmb[-,ags>UYuc@÷c<"M=w}v×vwY_x"5P 6Ɨ}`flf5kb03f-R ׈‹ZZ%-c4y2_+٩l;fk"+4j+tLMI&:v;ԹGT;;u]zqu12v9]}q |J5]=#.zMvݫe-ffDK6-czLl##] XGQrJR+5'E#z|\:S v-N *ԍФ뎔ݢnb7c-nՔd}+ gv݁XE|S[`amJc[>vCbiŗ<nGG(8{)4{=Cj$RϳK5 Xwb7l2hd[Z:5@ށUO fֽoՙCo9#j.U_DSql<2t[J"YVf5>¼ØN/%w_as7v^|C{?(o?{g߻_q ~}݁Qw_sjج:E@Lsq@1nlF#b<?W qј`u8`@aJA~{蟮 3Litu!W=Ŗk+ܡY)3I3F7st\M#͙o2ŧ%:Co|;Xk>xj28SlRtCg+אQl:K7#dwXsfZLm:֡q;U1{aJl߾Iyy>.WJgG|mj6mV~VمfM|ٌRfw.ֵ+8JscL +'9w|(:)oǀ~}gaf`Ѳ8|OnQoRdO1靁E=S3NuŏgY!Ơ#'{łWLbvP7c>3~v#_FG'VΖw|8dHRѷ޺lh}Wq|،ޢo#eThq蘹ѣ;~;E_W[\FQu/:\qFAoq ҉).+l''ɤ3⒘]qɲ8g+wZMyg1,P#ՃFqI7:Ku /ҞONr _f]e5;V,-?##7bIq~~~nBz/'*u˜Jѽ{/wCg[^ ]>=Fۙ-38&13-5;)&&);5-31 j7GoZꑖl6' eΪ;{}fڬZZH'x:=)>e3$27뛭ʟp}v;cvL<]7C7}KcX1&ֈWX pbS•ii꭮ˬ3ke2{խucֵn6Vt^|Uk+p”gO8M<0ܫO5Q&2&!@yCeeI7 iDDH#"UGZH)HRKO)Z볔 ̙dk̙{f̙3gfv٥pJfΜwwRc増3)/<{\raXOSƩ߬YiUi3zJq4ܬTܜеpx'Mr.7'O4YnfI6+<,Ғ|iRi$E ?`,g؈PO<-d13v3)bRYB͘9Ϊ3gO o1Ca:,f?SlaLyV;QYnT09h FzP6 S%y^tqM1uܵM)IYi;).1=1)]ސ$sR&&Gj2Ԭ^5e̶جqMxsIsz1F̿8\Zv6 9!%;1dMNY"`bҙ{bm AE'.OF^Z۱I_"䅟":'e )>4GOMNKN MMMtQhhhhXU4ES4ES4ES4ES4ES4ES4ES4ES4ES4ES4ES4Eg "J?N>s}=Y cH@ q,/b|J o%d|LD?XhZ)qWEy"oE>A 멀'}|`RlK`,23ydfI2&fŋ|LDge|,?$q,iX>jy+e}Ĕ"@uD2ơr)&s;<3s;1Bۙc"ʹyۙ繝yۙ繝yۙL"8P0 bnT|Ŀ²JU.\v,qc }*T ߆OX#o'FR/A [d5;lԡN:n%N.pAɬ$TFaYʃ4n%<{#`Ck 47=<;\C>;vcU;ʱ#׃ݶ6{Hق.\o5Dc}ziDKihVڱNK1D\iLA jf/ýta;_hŒ.ꕷ$KhzX¿[mu0O˴b~.D:f>^1.ٶ$G42G}v#gsE-,';tUiy'y 7}EsyGhجGM+Ckme$=<{̌^!SE';3 /]b FZ.S >Wx]\pQfͪ˘:(gE/bzGi ͧٝ.r7PsumԇP󆽙.ӉG"#}.5 `Y7Gms@>s?uy1+8|t8Þb]^s1l!;-bSU8k{I=M s>=!FΈBz`V>wt+E=t+pk 6jFv@vnaa!~y:#vXu;U\F>EbƃJ<:׵֗.ު;<eNK.qûA7.e\8 Y#vY#tx#Fi8tEsGwYx8WL Rs&}=~ >H^*:{j6B rql:,S16yUaiC||ڇjQn.qfRx] [ jl$9XZZȱX2y k;DXPUlr~xZmQ{L XˬJԨ8V:iʵP4fmTB1V.3Oĵ\b.i^'VT9eCj{a}4FhcsKث J\1gۅYlj|-/(w ;ot>òՒIS9nGJ_ CnP-xfwGg(6R0p~uߥۗCvyPYœձ\]6=Nu7al_WvY?lP+mQE(Nՠ;pL{v{tsZz AKuuNSR :n?tnOqܬ7jYCj-qvR(ruaM B.+\8 wp `1Ϫtu{Bn?6rP2 QAl0muףvqUwnbFͰ ы}6w5; &W*9.vٽUG7N)כϋFq,wYeRlK^p@Kِ*N@9@\fWGiᮧ12MĦDcPtu7qД{fZϊ> w;ۃpk>_3O+*) +Dr#`w./r}PPz 0΂~ǍÞ }hj7P9++fpԆ\ ԁ".vFW asmiTawDSL;챣8Kn秧Ь;u{n}^ |YDc Җ"u`(vp w@~nk:Y`{5BIٝZٹгp88},cp0LZ.gunsX|JhE}l0 6{uy#Ex _py {7.^ t1%(b^r ZssWD=xyLkɃ̭ ̔@&'HǍ&pa-tm@m`cKbm3U_;/3u.~L!{0s?>,oۃZԌVm !sQeV ܍i~qY[Sa X,w3"q@NZt[7[AV(GXXm\>^ً~#F }4~#l2d}a _g2a5%DHY|H -2oJ(#^|B]|b"?yII$b哓lXy VY]NHِ ll%J|NvflʎABZɮ@ٱ([X>['?B6 e',Jl^E'!E(9h_bcXˋ/~_<kbͱkYA1cXI5R )488'ƿBVL`3IqB czjՋ8o#gCzd#6PZ#YbFch](E3}I3%Kz|Y%KZLc$&xI7&Zġ̡׮eù=UVd5fj`U1}&f֤UIGr?`aaϾ/Zb_;^ddG+Ab_04dbyvٺoȏ<{[Zڀz@[z,+ Ǝ0֎Ri(-މҲAirXSތW9 P–͈{1T0CL6ð~?{H&NA΅+q֣Kp<[{+&#IR< @+]5x~[{I$t\pͥy|A+ 2 zǍ|~?_$G[F)naV=>|(Y f4WNC& ^e^o#pu&s5$gJc n\_R6xvK?_x!/0ƨEV/`< ;00?_W107t__ox^_o$|,)hCn>s&4B>^b`஀b<PT !:gdT &a w<Owa7m3|"%R8>[p'iO 8)EQtO!X %L"t=Xpac BMX@XF8af6#\DFI% 9]^u  |%Äodh'l%l#tz[#|9݄rz}] M.  O37Z^{|a:a.h#p*aa=<ńKC+^w(~ ݄>OO 1d"vwY_"'k/; . wN b0f-o>nq3n{٭xϺ 5_w-NGvԐpy0咰,~EpfboL9-Z. / † b%B ̅y0 %r?]Ngq2Д) q;ss a%P 6_eȇ+.Jb՝e .]^w%z7bռ^ ZP S{~L$t: ]n%7z>B?Aa7Re { o&\Ax J[ o#\Ee~ WANµw# ݄'pCD>n"{3ܳ~p qrX}zyP~JG `H2b,Cao37 2 7ZSƥƍG_3mLRzҴ$oҁ7KJnMv&'J>Ҝҗlʾ)S>2mOv֧.J]:4KZvĴii'J;v2ݘ^^ޚLoKߑ'PƌԌҌ gF(?c c[Ǝ=2e4ffgfVef:3C2wdcI)ͩiqrsrٓs(X\cnjn~ninUnk37۟;-wGCrORJZymy;;wrqT|;0:弡S| @/EcjWxOg:ޫ7EϿЮjy1-QGwP3o~.ԎxXSOR]k& qmborԟ/K~ItOq(X}Ӡ4AE?wĬ,DnOзWkZ+u!> /.1ڥihA{e"-{ ˟WXwszOsBDk9E6Aڎ+ݬC.ޡ f@C+ޑ VJn=i.No[BAbnnsug܈GQKu|_g_+gcuX#ivAO.v)Na;޾k .Hɣޕ+wM:+ݵKwtQfVw-e="$Dǯ թ>O[s [i5Zs0SsNqz1f *|~kԋa4L0A<$xQN7[D"Vrk=(IG=Jk*ƽmVԳ8F?8[1N{|68Kεr"}31=.wzB3-1{SgŪ{Z{w`6\JĜӓgT]1gOrSzgGSkJ~󜘝Aj5ľ"ƽK잻gYqy1?Ԯ!~h1$ېCq2j~1a G8-qg¶?'OrC?bO~%Uov zJbUIzr^E/޿SPo^˫=|Z;y|@b}D҃cOqJ.rh?&vlvxx`gj5fS&NF_7UZgm-XW~-oVq'i|V/;߿#vwĉc#l'?4Q˟f (IvMUαO-*8['sFD3'TkP:I-(_XdH %>A1.Z2x)FA++qV%V0njxRR܃\ m*$K}h+ŷ #dGD)a@"dj9b4 V+)bޔ~A=isK l % DU͜&?-dR%=2t߯_{u)][^h|ZܐiԎS3jQ-Ym<6jl&K hqf]M:^/^˫tmQ<7?cu'RGZ>+6iHǿ'Gkj-?vtD']jB?:uBǟ,{^gGO.SNjj+48ϜˍZrv~k-ZU:~NO:5-?I7qߠ7mZ7>=Z~nZ~^ kwCGNo)kiEh_@|?9sviQ5Z>ߢ/Oؠ|LJZX-AT-M?ߜ埩7iZG_Yٯ叭qN’S?ާ=߮wxQ@|#⤃% i`[?FpHAZmLId|1:eV٣ )t3 /+Of)2~R *ӱvc_f9^NӬ5kM>on{+k8>v"}va^ڌXgmA^i^5;Wyqr WD*GFD*߈oϭבJzzO^R+Tr݊Mzx/hU&Jp-A4^ "]H]FI>X+}I ]Zi-#m?t *U+ x1r ld$#y <$O'fXn ^^oWn_=y@CysgH0(P *8c3IaÒ2>"MC*1L.i!&442S[cꑦ^Y#]ciإ/IIjy- K?%ܚNHXCrr!Q1$)W(Wq8C2A`)W*WR iJRdHW&) JRjTʔ2C2UjV) 9 e!W4)YQJRaLR R.WnTn4V޵Pu=G%qK'IrKH$ qHnIWHBtHrKHr~kn>o=y{Z3C5{TKrVܫ^P/@z=ĩNSUgW/!zBz PHSC5P m6SC(PB W>5B5Rh5Jd X5JqjQx(&PNMV@5MMjԧSHT*j6 |7~[00Om?qw??ٟ Ci4Op?g3a?˟)~ s`?ן y1:f;Τ3,Egu6 Rtvf%z KRB/a^W—z^jz-uz|@4X7MHo[`ަC. =z,>XB҇`>7> }'IXc&Ɗ`mcw1NbQ1 ֣ b2d1acL̰)&kLV [br䀭19cr¶{c1ycŽ|136{lE؍ig%~]QĊ\"fKh&T.[Qq*^PTU\ݧWTUNUzH5VϨYFUTGPojzG S(>P jHMUjR5W4֦XVUjZ֩*MmR[uLN`E.Xl]TK*? tîk9Zy)Q/yu^{f5g #8>s"[~gp|9_7]Ȝ6'KaWQRTUEm@4D;E}1MDKV$ E(*"M qN\ dy #@ve2ԄzCݠ 04`,,q0f\dV:{K0#k2bFi#Ѩn5MFH ;E&E^!A1ғSaRUΑ;v};F^'KysM$ܮ?a["" ;GF &;a¤;#ݘ퍶Sڤ #"C}F uu 5.akBkbkRkrPP״Pǡ顮OB]CQKd5tM!]f> u u}/C}B}C}B] C]B]C]KB]_VV u ])4j HRmkukMkmP PPPזPpܶvvvvVuku8u$u4u,usD>B}H ut] F slc0?=-Yh K :fx> Ø18'8 0Ogl4>?_+œZs3_tzB/xzk0 sݗC*| `!fŰ ̃*6z] ~YJ5+ci MnT̸p o9 cFFN.Έcm{wgOy0L2aĮQC`4QyF%So%Y61k~-پ$L xI0 S#?qe*ls1%$nFWгa2~4 `BO}%7QLPLnh.n12ۊYx/9z aﰡlޥe3glle_yl>Ke_l![%k-c }Voje߱u{m`il#6-l+ƶl'v=l/ ;#(;Ǝa')vΰ;.̮:xTq' œh}S]<-gDsgxNϋ61^Σ+6b*]nG~5C8"cqRŏ8yqA\eqE\uLv$&)l@ R?ǎu o;%3S ;95n{X 6&،Va](c5 Fdl6[mvce6{}~q8d6Gcqq8e6~4gsyqѸd\6Wku3jfd|@V*!YUVe YS>,kGdmYG֕z1Y_>.'dCl$&)T>-gxX֢!l:j;2h7+nuWBw3٭hq݉v{3s/K2V~z] VkJ7W+EAwZN }pD]fU/b"f9"U,+Z&=8!ΈK 3 k= xm 򒄍y)&4S aS^i^/O @؜W$l+ U/Gckf H16.n5ގηa^55;!@>y>̆hx y! mqƢhbh6%>Cۜ'mGے'w>Dۆ?E^m;^ m{^m^H0ѼQfF&Po&`-@xfN|Dj[h5F{ݎ0Ůf*ac> )>)A i>9EҾ3@'gww^s^!nOX((@QGQ;;"><o4J0I3}`k:dg3|Y,v8_;Keru^ PTsѹ\v8Wku;}s#w;~s绩wqC{=g{\|/W+ {E^1W»KJz^W+U*zDTT)Aݡ2 ꢺNhZqabE EEGEw;"[>eOk5e[Y`e ]g?n?ݏ?n _neSEuס:_TQ|}So^ 7ޝz/ ks.k{FenCd11;17)/HHyR^[LnjS% ,c ])Eo po^;?_ż9v|rMuӧϛ8lnm~ge[4n p3,zG,,ܫjkgҵe1+Ƭ~ UTX1`uß}ZS»*^ox-pnzo3o ތ?x3lY 1Ϝ|6ϊ|s&9+K>goXΛHOeAM:z?r|3&Ű:?j=^z~_UXqO[ֽ1M,*ސ5e~)|ˍ ~ݫ.ZRnpv<'ϱo o <W<[ʭsϙ?? ޡ?/Qc %?Q/|J{˧Javo]A~>/gg|/{gaVTa?$#7g͍ֈ0&;]݌F?ľc`hđXc"xc1q1˘8qXXglBL3{waT!1NLx4Lic3"f09s8@Yd@Yd!E ,b , K,R ˀ, r ˁ, +J  j  kZ 뀬z 끬 lF l f l [l))+T* TP}jLͩaϾ6{c6Y6T~s>ɷ0'ް6ZW{1xbir(:PWwzF!.3flG iu/s9qm.={o}ў {C3ʀmB= 9(碜 Q+2Q@*\5(ע\r#'57b E{Yr|L_;}Qd)-m4m"gPޛ95Ѩ;SϸEaZfA,|lR\=nkƶVnD^̮pLZutgS[kLi(c&̐#wvIoaRshSp7yd S]v&"r>f? ̼p)5`~у9s).J%ւцU۩=kߕ<,H ZRٗy}Ra+amN-{Z2m"R jK:_Y!WKb21&)CY?g{D{o~fD w wu<=ddlNe$y7X33=rr GׯqxV3̊S;T2˫f q sxP65g05s9<~OgkVI>>zs_yb>_#|.\vO9/d 1_ϭN"w( ŭDȼola{n_Pdo0Ԑo5-ܧX*u(ٳ/_:?$[]_纥uN(]W鯑 ~[k.!ASV3z&W+u/OU2W >jc V_  8C uylӊDN"ʜmLo"jf5CxQz`In$As7#hehzގ -7E5Pok̽wI\p5he~<+(qoK\ Hk\-zh%u)Şh~D|-+pOk 6vq: w3(;85(@x>B.Tg1 ~wS|O_/K|Wi3M2 fQEMD>=DOK}D_O@FzAlfElKb!^WNKɀL'cdzAʌ2,ȬMɠRJ%ɛd~Y@daYDdqYBdiy!5YK+kdy+l(Cr,ȡr|X>"˧D|V>''ɹr|AΗ/r|Y"_;.ZG~#GU@S1*CUWw.USݭQPԽOQzުf=FY*IVϫ9j^Py-[:EmU-jگuP}uX}:^g9tNKߨs<:AM:. B.K蒺__wo{X7; ?uqnZRNUe#نʑBNӨ\ QG[gyTT< UT#64hzLijZDszpL޳HP{iB.Bb8KҴoEooAC+$$f1W/bX(^bD,rBjI,~QqL'8%N3%mMv=dOK}d_Oh9Fx9A&y9GFIn[VM~$?SyD~&?_/)yZQ,UBTTiUFU7r*JUYݪTUuΪz@uUTwC SGp&)jjZVjΨ3:ΪotjVZkGӾY/= rh4\Z -WkCr'hZ m> Cwgg猽ojyXh1Fx1A<-&gij91ILST1ML3L1K|$>SqD|&>_/WkV|'?DVeQve*O'Sr.gșr\.Wȕr\-ȵr+|O/?<&wyReW9TNKݨr<*AUM** B*bjU[NWTGI R5TQc85^MPOZj:wuRRMҶt:Ft.-Vcԩsg^CgjhΌ/C㲧fON 7)ݟDbR,"Űm+(#۹2OYEN"GyOe͔K(ETnwT@CԢBl#':>/zG E{b&gq 7t"݃ÆJ֚+^a1OgZu6Bٛlui&[tԙ, ԸK>Ȣ)bil\lcb<^֓zPߌ7Ng k|0y^Ku}55}-5p+5sj^i+sEzBWwSnB:I/xwyiYsA? 4gQ1q~@9]kiQY˽nHM#Kݓ1Wݘoof4H/-sî1Viek23؎1vZ"[V])VG! 3l!6`[3v A}HORgUS wΉq28LNf'G9q׉wr9&'S)q:%NfSީOBlkCG'aSfͅ&k^_D̻#񽘴[&Y>[%vv㸰vͼ8W"TZ8e˜2"Myq9JQ6 RSأQL,^ef9/SeUx}[5e+Nl?uw l/ŋ2[A/wY+AX{9ލ^n++W+fJY2^YWޫ`*yX*mVwuwW*5*Ƨd%^#v44)pO pOY 4ܓc'pOr)&=0S!=1S1=U1SMi+{qB Gd9DIDEQI*=^QG/ڊv~R;.&GhMWa˂زy* [5n,aE HOɁKדOItE,5b*?u<[L|A~DϢwgb5y٬s=jrY-<^W+nJ{6^9+ѫUyV{wU:ywy5^Siu{{V^QIf1L)ә+mb*jPrA],Q~(CoXmXzGLW6،/qޢo(nsYyuCCݏZwb숖&ꆺnSۮd,QƅOuD݂ĢksϘi#֩bczRuLaxp^/dV%Smaml|Em.=]&GHCO ;? 8K(fw5(b-W+Ģbl88]nNwv8}!pQg3yyv: Dg3":GF1=4U=<4-T_}8.yZZ+\gSD;o}o^ӵЉ++;D/xNyxf"Sz1S$Q&3M,+(he8n52*,ItU=q'ϒǨ#$uRižԕ󬕍˧Xx?T wpGan7#vx%Cn|k$n'}r̔ |]!ߒwKޓ8r*AC5y *>N_xAу~2;ϙ3 杳i 6ŰU-( $@bK=[4+/z u zX |[ņ]J? <]]o$_g?`C k3e4㐲SGm]Uj2}C'|}YEqɽdfPD4-^Xp^3_oi^~OCMF E ԐFXJOAImQi;[Mh'u?=6y[] }4._`4oY\# Vsx lal p{R ׼aFny5ϡri@ExƚI=;~w;cf5de7s# -S ELTA$YfKVڰPzTv^7QAKIS6&3&Si*VSwbr\g)ʪIN*qz;坢;|woBwEjlCm PRl ijsa fYeey+W.|cLǘWe~TTs3ӻ.U5M(&1e :c纗#svW}ȇ39/O<:atx㚺GJyw;C}*fTJ5lw9L9O)2zޣZnq3ܬ n67 Uv]@N7Mpܛn~m6u[-Vnksۻn7qgNj5&/E~1r^ ˽K$W 5:5Vռf7߲[/nm`;עv+KQ[-v l=)z/x󍵂"+&ӱ:@<i/ы}~w͍eY2Bʒ$eD|7X. 먲S-X7{#:jcU7v\ [;ʆ^cUpYev6DnWz<6 Xb)6F Ɵi$5br6Xg՝N;Gޯow{B>Ųg!'߉w#WNIbeM=4g3Y^2gYv8 or6;[ѿu9{AC?r>v>qqsw~v~q~s:ǜ  QN Q02hk/I({)9>~f~2-WM<$/Ie26i/jq 뜗_4ў*]%/S.r~<-KҎ˛lA@J+MJy[%b}몰. =%_梪uD󗠹9eWWaۤn7[~$<*9Y>dej^4ϯscDښl1zn{\A{OQ9b:O[:=˗w(1e^1R'~E5f$te34 +hxsS&pfezsWx.и 3*mNsKAz %{QqHg[tJئbO5Zc1[>?Hd7ٍbq^7Fl L)V&$YI)<.SyZ*N7eSUS*oT ^ab9S&Ѓ`ZyF.7dgmֽU(Քs#0ݘa!`h;/~p3epQ±͚|u<,9,ĒHb gOc9@,VK.ዹV\ZfNbfaFY;/g WxR*BhOg [Z贕dYJ ZŭV%UͪaղZ W/$ck{q 9T~6U:+&=l+ֺR\ ŵ\V>UgVi.K[`gV粺uXuc5䲡՜V"V'.;Yݹn岯Ys5֓\>iCebMdYkӬ5{{ߺ{p{[ۨKUo.{ eແ}E}?P?qC;~BgP̨z?FB0ԏgGs3걦gBO(A qקC_|uNڄ1v&tYXs ƓyhBTv{~pY4pc%MŅ1ԇrACyggI4o7Û-^{KjDEx#Vk887Qr6|Sib9MȜΆ22[ ;2;AQ\r]ah7' 2X.o~/M shsDL+f|vi|y鏜g;Ӑ眦&cz  Ș́\Ș͍لR9|r9wTb`_qwwڷ|ۏ3~&?sdl-gQmQO\O%ņ:|(sЁ@$k^-*K(s23M>1?}{Ytr_K>_{\ѩTunwp9 NKu9Ng_:2a ǧZM OrGu$,\~y[8ЏpR9'ڜ'$kcv/?QU1UVݎ^kX|^x6ɧj [K@~9j_ݢnE{/ 3ܙ,7ɝ>qw].q w]q׺w݌| $t~z?#"C~:J}.Sÿw {\(?N~O uITpx^}Oߊ:\dz1QLd nC<')䰍މ u5J|=n9{368UT)2-$s G~#GUz5R%ќ1 <:j>lϥ/SfCGOwo_ffkuvK;dwڃH{=dϲK5&{~>`_ٿ'v 6pC@U3HxuO2#1 ""*Hp_J a۸Bpd]u]TT@VQP]?0XxWwuΞA,O3333gTxzVzy6x6y^sss$J5RmT_j$5ZJR'[ eHR4^(MfJ%[Z -I &5i]-} }&}%}畼IހW&{ySͼ-mݽ}\(XL}»Ļܻλ vnރCco}{%B>w/woe/7W+MMX=--{ v^ǾC㾓 RB9!MP7~B m:&tMpOBvˆbZsie"$a295_I)O"#b$JZGZG#/)$1/xmy9fM8Of>Ob8OY)*Gii(EJRi(E/ErOHHC)P4"IsIet"p Vbub{w{wݰw7 {w Fw2Lm큭ѓŠ fl^z6ؽ惣A,')iŭŭh^oGoF{oA}惣A,Y}x}x}x}x}xc AV}QCT ݍxw#݈O_>NOÈ5|*, K`rҾ { kJUXʗf=@_'Y kK@t`9,M G"a r"7,`9rsss=z0B|p4e ;׃`~s=Z42v@h:b8`ig3x< MDZ-Evek4b ˾Lܠ`\,!+sd# q uTp^$t BF9Lg͵:Ck\fh\r[.CLn'4NGÑ{rCyMѠ,<{=s㹳4F1ZYm 4o#oA#ѓ{2#Y|il'3dFaQ|QXS׬P4 6(wz)RZ,@(@h8,mg ^J"BP C!r(D(oe K{ O{ O{ O{ O{ eO&dǓfYX[AZ?*ATQU~PU~PU~PaEUU~"ZAx?h1tANTATQ Vt,<~:^?J]>B͂Qk3%xИhL2&e!c1͘n0ʍ ӘeD"Ki+8/;_&ӫ\:C`Nk>$z͍]qa\]qm=ÿB{BG orOP~{_&'迋{`8'\OV˨`#(OZ-a߃EHO*_o7Y6oF0)ϥGyjH핥fH 3ן__)"MI{xf[g!ɍ!Xjɴ* hZk{ohGx~5^+\wNv%msz>|MHpDp I NN!#hD4c^ABU\`۳̈́y9Tyu[s:;k sIf+u*pѼZk*-NsMuO"ڊǒ d2ÿ_N֒U|^:.]HX[3P웑}a5\'|mmx}q|?)&IܩtS$uƾ!`8 31K(OQ^p[p=$q WE&}#kX&F3[ vc[lV-4&I5 ^ӳԁQͿIxڣ1mNXKeU>C*}̲Cack#]AhˉRÕspHZV^~1 *bTLy{yfx#rm9Y#ו)r}9Un(_+7oooo[˷r>}C#Gy'O O?'_$//|dsR0I'[II'rMO/䰬QccW.gzƏ^&. $qC+f7~#O[ 4Jew ]bi1c9[R JJ$z彙7;i2;ٽ^5uWRMM4H{׹+T l^6o>Ý'$qFE[ʽg-E@$JH"S#BDX.^^^ ;W·"}buBbS>ZNbW 0qX$K) q.F-W &lC1jz{yUhQ\QbOgggg,,,Unn@@?+04 &l,0,CZIHrK p/iCn GL Jd)0530' T^"Dּ!3`=J0 ^ 5`#Z1l ^67-M-`+5l oۃ`' v{}`?.p8 fY0<0 hǃRp"8 N`98#hG9c\m]p8|\V'?'%SRip \W5ZYp||||HW<&m''? ~$x0i/_U;<<[g5یFGjO4%<]=}? n|#fpKw[۪m[g0n4Z77F͏^s SؓSl]%R~Bbpfu Mp 6nw0-M-`+57/ ~~~ GW׌HpX"^N)F xXL k@*6J'/8 8n#~Jֻbٕ+{~Vz1^T*ٓ:ïE*JYRf(;`*%GNjzg'$42Tޚ)tJ}Xwll$]3,0OhC(p>|5,DOFfIN i| aώw>lfs{tI>^SOCnQ"~1'W)Uz}jPycw0yc~zGwԻzW]{E}фhhhb4)zAT^ DP4kHtn3'bgnW`Ro?ɁL$9120^1L|(f>n압ߠ-3I*O ;.eG٫S6bIeTyZY<,WV(+UjeVyVYWSW^P^T6(+(*OyWQ؅Ү9BsCV9ya=l#E59|yYy7[oo o $R;"R?ru$#2.RNsQzj̈́WT/ދRISmI}c'([ z5bG KDZ6YLVd3A#䤐(B*4 ]BP(LOFsSQ̗6e!,GKG$ZHMZo2rBn^ݸ{q]qq=qq}qŅ? >4.Y\q/‡‡GG_Ņ ;68U'{kzac Dz &zL~Asdz6+GigrvPTAM.6ns.;}4v7{kR=G~'Sn?snKnq{#+nX1q z~lme?9H[˷HKH"4mЁ nFŴLfҶ3_X,, W-apP8"|+b"б)b#oѐW,kg>` ϫ[,U3 n^ԶOhZBӹ.vaFȣ~ nOLVBnvj:Wsۜmmmnr;nK-?~:g}-re\9"nq ܾZIVR|PN*߫DTQU}FTSMTI$y% Ld1bngJVɧzzzZ[LMV/WPWOzZ^~i6e~(Y׮CBτVVVDDq|/Q(Sh'a~eR4EͣIWi Z xkID_=jWh+*v5jhkZvL^kNOez|Z|~vҵZ7C }@1K7Hl4I=#Jw;I+~6h56F/ikIDϡ7h7h-M-Z+Fknki۵Z'Am6IiS4m6C+fjw#ieiClm6 IkyI=1FfD,95vl˟ڣ?('Tʼ1_jNUmަvPoW;w@-TGEj:FSǫ+xgNvURz:A}@-U侱zҫ|o8/cjg=NUZΌ5[}OOf ҭɔ_EW=j)BQ`TdRF8-6%z*4]-S>+}.@'"aPJ fsRa%}> l^OۅpL>%e1BjuIRl#v;žU3q8U)mqX\&7w]!f<k`x(A0F@@4(x1x x)X S`CZ1l[7`'0 ]n`w}~`.p8/߀߂O3F ("%Ky^gӴ Mд Mд Mд Mд Mд Mд Mд Mд Mд Mд Mд Mд Mд Mд Mд Mд Mд Mд Mд Mд Mд Mд Mд Mд Mд Mд Mд Mд Mд Mд Mд Mд Mд Mд Mд Mд Mдy^gմM[дM[дM[дM[дM[дM[дM[дM[дM[дM[дM[дM[дM[дM[дM[дM[дM[дM[дM[дM[дM[дM[дM[дM[дM[дM[дM[дM[дM[дM[дM[дM[дM[дM[дM[дM[дM[дu^gմM;дM;дM;дM;дM;дM;дM;дM;дM;дM;дM;дM;дM;дM;дM;дM;дM;дM;дM;дM;дM;дM;дM;дM;дM;дM;дM;дM;дM;дM;дM;дM;дM;дM;дM;дM;дM;дs^gմ Mд Mд Mд Mд Mд Mд Mд Mд Mд Mд Mд Mд Mд Mд Mд Mд Mд Mд Mд Mд Mд Mд Mд Mд Mд Mд Mд Mд Mд Mд Mд Mд Mд Mд Mд Mд Mд{o1s:a#D% `M02` /kdJ0 ^ 6׀ׂf`s%x l ہ`'0 v`7; puMQQp5MQQpBE=GC >-hڂ-hڂ-hڂ-hڂ-hڂ-hڂ-hڂ-hڂ-hڂ-hڂ-hڂ-hڂ-hڂ-hڂ-hڂ-hڂ-hڂ-hڂ-hڂ-hڂ-hڂ-hڂ-hڂ-hڂ-hڂ-hڂ-hڂ-hڂ-hڂ-hڂ-hڂ-hڂ-hڂ-hڂ-hڂ-hڂ-hڂH64mC64mC64mC64mC64mC64mC64mC64mC64mC64mC64mC64mC64mC64mC64mC64mC64mC64mC64mC64mC64mC64mC64mC64mC64mC64mC64mC64mC64mC64mC64mC64mC64mC64mC64mC64mC64mCv(އ/Xlvv=K_ I@H,&jx~|ڗwT5nP_KV V9m#KcӿVa2mb'eZ 쿷C i/zQh aG"D*{{hLK^B'eX m~\T`8X<-𺘅O%2LnW3_#pM`6,,br%| n˹|XyűEU,żyiI`po2d\x(osKFH87<)$M"J HTE3mgیmhgz9Y9Y9Y9Y9Y9lt"p>8 xZ'f͚ڧIlgx&acrrr,swP9br%| n˹X Y9oghgyͭ #n?BmvvjOh=?BiiuZ E-e g6X =,>_ip9X >:™ G@,]tt9ANGt9ANGbְ^^ð(iDZqywH3zf+N ׉I]Z4V0,+ ir$2qw=GxoGjZ1SL2}w8ỉ̋229IYM,a^>>N"o'>"ͽKjwٗ8o7=FKGeK  Vb'b{{xAYZX<,6$3P7>3zؚX8MT}lv?95#VF-[F4"atR]pH\tIl]6(n-nmnY CvQ ˡBA,Y x x x x b:`ld\d|$r9#c(M;Ú>&k"pY\8l=3?ߜ@ΏU8?VXckXP~~PS߳gOEv᮴Wf>s蝷e%*1p ݯ>/eC\p'bL7׬:ӧ=}Ԍ̏<%}Oex#/WM|W/?+NKB/1)q&o;nGWk| %|*qn8xFo;.1|g9|_M|#?/+EDQR «) E^ѤhU+:݊>ŠbDJZ1U+7wG'gRQhT(.Eb@1SL(&39ŢbETl+v#ʼnLqR(($J2#"hNx'*h"Zv&AbxE&YbX"V7[8 >Og '"e)TI 1AL3H&MqBqCJPY,SbJBI)i]UqeFYlR*ەnerP9||R*KU[;{^WJU*Jҩ*U*+ur[W)Og Fy|TITU S*JE***T5zUUծTuT+kՔjV5ZRިުީޫTTUTU_T_U'uH].W*NmV;~uDTWk fsRu:Q.TW՝Q-QKejLM)5:PרMVuSݭSGԯԯSYzI~~~~>PPTRVQU߫|,%I"ut~2B&*l %CC(9UI YHe$F$EҤ!2NV5d=Dd'M|MNi5ERMFQitƩk"JSi4kk^h^jz4!ͨf\i59͂fYـ*55^MHThj4&M]өi5#Wך)ͬf^YռѼռӼh>h>j>i>khj5OT>UDR唌RQ:L9)?TUK5Ps!j8jQ 2FmP[GR)uUR5T=DRT'MQzMMQR+uO=iERmVUiuZ֩k#ڤJ[m6kk_h_j{!v\i9vYniw{CT{^ko:HW+*}AvJ;.iWooڏO/گ{._W+Օd:N3:.Kt]GׯҍunZ-uk ݖnG;NuKݵVb=GVt7wG'gWݽI/җ2JӛN_'UZ}Y\BRߣGzN?5~KsZ0@C6 @ m` !m6 -P@AQIYEU2 r̠2 f7D IC`h6<704 CQø3LròaͰa2 cépi6Xl7Fjt#kLuFca21pox2r̨2f7FIc`l6>704CQ㸑3Nsq͸a2cxi6h.iFh&im4CtFn;.1zg9z^סJZEh3tNUt-@7KQzi:G/Ao;}Hӧ9}I_ӷ 2M>n"M61&֔6ULSe5 Mc Ӥi4gZ4MmӮitd:1A*Slznzazi1Lqg6L eӚiôe1MǦSӹtm5=!s̿4fl0[n3cfishn1;]^y$B[̆emvm[ YSzm> [n#m16֖Ul[e ؆mc ۤm6g[mmۮmvd;.lW۝.KevN);m۽=nMV{mGJۭ v؎q;i7حv^go.{}>lO'39}žnߴow#~aQ(s`A9huqGQhr:nGc1xxr:KUҁ;HauuՎ:Gpt9zaǘc1q9+uǦc۱w9Ng ǕqxtJgsNI;N3;+5zgtv;+ks9\r:8:9;JgYs6:[mg9v9'sѹ\wn:}yp^9owGU*q0\BUw5Z]NW5qrvMf]%תuzrC.Wk5sM&]39עkŵtmv]#׉urݸ\n].scnMiuqw]nrݝnw{=~~rϺKU[;{yJ=GyP{=^tݛm{}>q/W#zJ}ER_OSt>"Wk5^^z|!{>$B_̇}v}_ku}}A߈o7-V}o|o}|}OϾ/{ߓ?_/e~_7~?Oڟ/J?'^Wk&#W)޿_????O@Q4PT]pH  ́@`(0p@.X6[^0p U⁊@M>h :݁``$*:0 7w}gR1*Fǘ'g"Lbjyμ`^2=L?3Č2 L39fYf֘ faC9eΙK暹eTt2L3Ȍ033K*y˼c3#|a2S0?X, eAUP4A0L`syEe' ǃ\p: .kVp'< Ou6BBBx Tp68\ __P~(T*B.d9CP$ UjC ЋPO?4 t(Z-BNh/t:Cm! a806aw t:\UޅއBBCBC_B_Cp~(\.ª.l;p$ Wk pO?< t8^/Nx/|>×m!E "8D1Dwt:RiD"Hod   ߇"Hi<""9#H2R4D##/"/#=Pd42"ӑ\d!YlD";a8r9\F#(-G(ţdFQ&Fh]1mvDсpt,:D碋Pe<*9h2Z6Dϣ//=Pt4:\t!]nD;ѽa8z=^Fb bfgIZY7˰,f:maeav`'v]dWuvfw}d#lbk}ξ`_=l?;Ď,N9v]f vaC=eKebP VcH 1CsǘKǪcuXK-bñDl26-Vbvl7;bM.U^^zbhl<ŦcBl9ۈmvb{q4v]ncq(^/q$ɸ!nLxc%w{X|">+f|;ߏOgU&~LHDYK sx._7[^0~?/CJ$pI 2aHX`Du.јhI%:]@b81HL&fsJb=N&GY"qI%da$YĒDJI{қ %Ɋd TJ$iCy#(Oxb!rrDS< DSyObiDh4biB,<-!Ӊxxz/O/G<Hg #,O! $3?B*xV <+*Ucg5KDjx OZȯx Y篑zoxiـo1bx 0VW0V,+}W+~_g3#1jc?EAѠhP4( EAѠhP4( EAѠhP4( EAѠhP4( EAѠhP4( EAѠhP4( EAѠhP4( EAѠhP4( EAѠhAH_! _#t Ț@J?bw2"Y$!OF WdD$噇-x"OAΐGyߣ?(>C" TP/E@'!GyBP -3-B -ArE1T(AGA7h>Z~ T!yxgȳ<6/WWטגזבוכ7777777wwwwwww(H %%2 &!$%^IHTHj$&I])I%#Wג)ɬd^$Yb[;/` JG` B`lP PmjC6ph =غakVȄޣP}¾bFo$~X0`3_"( (P HR&@3 ht:]@/` SiJ*j_ ׀l-`#6`3lsV=10P `><ŦPhMsi4́94@hMsi4́94@hMsi4́94@hMsi4́94@hMsi4́94@hMsi4́94@hMsi4́94@hMsi4́94@hMsi4́94@hMsb h:΀3 h:΀3 h:΀3 h:΀3 h:΀3 h:΀3 h:΀3 h:΀3 h:΀3 h:΀3 h:΀3 h:΀3 h:΀3 h:΀3 h:΀3 h:΀3 h:΀3 h:΀3 h:ΈM,h: ΂,h: ΂,h: ΂,h: ΂,h: ΂,h: ΂,h: ΂,h: ΂,h: ΂,h: ΂,h: ΂,h: ΂,h: ΂,h: ΂,h: ΂,h: ΂,h: ΂,h: ΂,h:+6΁sh:΁sh:΁sh:΁sh:΁sh:΁sh:΁sh:΁sh:o>b:sә33g]w]bf,gڲfO4L#gGV|B#I|B n}z˯7_>}}&~W*EUJ eh%Z֣Mh+ځv} :yBgϛ*n{!zW->wf]9ެIQ`xAALP(( AMЉ̓{5yV F/( *5zAU! #q`F0/X 6ۂ=Dp. ϟ?'\ Č`A,b%X9Vb X3ֆub=X?6bXE  ä cVhb jz k:nFql %l=;α+{WCfB\HIQhzAaLX(, aM) a\8+\. ׄ)BF/, +5zaU! #qpF8/\ 7=Dx. W3l<q'q#n=xx ^Wxތxޏg|_7|?O oRMx+ށw} >S >/ ~_"(C-"BD"# bBQ\T%5EmNQ_4$MYтhY&EGSхZt'z}1W)W[Y*p$lIRb%IPJJ$*IA,itJz$!ɨdBJ$˒5ɦdG/9J.$ג;ɣMHL-KR,uJ}Ұ4OZ$-VHuFi)J$ϒWɇ#͐fKsR.HҘPZ"-VIk fiS#IGҸtV ]I7;}Tz!Iߤo2Dƕe>6dbBeNOɊd YN(k˺dٰlL6)F dٲ\.#d(<,&+eUZYY&eCQل,.-ȖekMَl_v$;]ȮewG7\"(!&0NG<(%*jh$Zv%ab$9bX!։-b8@ $bD!QBUD-@4mD'CC(1AĉYbX&ֈMb'S₸&G&G\yMT.+ZYayH^*WyK+i|Q"_owcR~#?_yA,ow{!|B5|G/?/;M(LBP( ©)ŠPԗI~'SHE)%UI Oed%YC֓Md+Av} 9BSHII RKI'#dYDd5YG6-d;E09FNHKyIސBkR4}>[Ǒ݀nX7MtݺnK;tݽI{קy,}K*^oSzZ2}F_oҷ;>~D?KU~[?ԟW[Y0p lC7`4 CC +u~W?֟/7{EnH1 YfTj 1 eJCdh5t }AÈa0e1 öaph81 óa3\#n$h=Ơ1f,4ˍUZc)0\n 'Ëݘb9F(5zHi#c7ˌcj0vq8c7.Wmxb<7^og1eM&DHd7yLASTh*1LSi1L 3erLIjR&2&Ɣo*6*M5zSa6M#qӔi4oZ26Lۦ=ӡtn2ݚLϦWӇc0gs͸0fn昹\b.7Wk fsc7Gyּ`^67;Hj̴1盋eJsdn5w}Ay1̷aX2,ٖ\ n!,h[<%f)X-UZKfX-CQ˄%n,X-kMˎerd9\X-wGRi[,K2h[,3y˒eղaٶY-'s˕`yZ>k5ۚkŭvƬkZkm6[۬ku:jƭuͺiݱ[ hf}!6-y-F }Au:e[ uzh=[a2lٶ\n#lh<-f+mUZ[fmCQۄ-n-ؖmkMێmvd;]خmwG7ۛsϫ]lWصviHmɶj۰ml۹vk{=^mv=ÞmϵvNڍvccB{^e7؛mN{>dOY}پfߴGS~g9ב;Pءphfsy"GQs4"s`?G#ۑtvtGQhp4;Gc1pDzcͱq; ǵxs"N3wNS:N ;ERgYlt8۝]^s989 g3׉; '4:N39 %rglv9;=~s9;g esӹw9OkB\\WB]b¥u]Nv幊\ Wjq\װk5v͹]+uR2.+芹 ]%rWjv:]=~אk5ኻf] eךkӵwN]kםF!ʤJ)̔Qa**J zj&ijZVujڥcꌺn{*ZjڨN꧆QjSLQOQuMQ7͍L7ߍn[6n;sKjwnww{a{=s/W-}>s_o'ݓy<9Hr'q{^sow#}s?<=GQxyž|}eJ_)z/;͇L߇>O3>/J}j_kuz}aߘo7-V|-߮w;]n|'ߋݟ9~/zOi?wL?ߏ~_7~?Kjow{a?/W-?_o'NytCcVzJS4M3t>]Lѕt ]O7ѭtMу=NO3| RBPV('!UHbBPY2T5ZCP_h04MfBjh# NB硫m!z }9pv8706aR -VB롭n t: ]nBK=慳9a,, 5L0•p})wƒxx*</W^0|>_ok#‰dD#G_1N,#ˍ1"Fƌ1{ bXI?sKG5$>Xz'$𥉥/K,=|yb+K_Xz7&)͉oI,=|[bKߑXzçKߛXzçK?Xz?Xzy_Xz_Xz?Xz%󉥇_XzXze_XzXzïL,=_N,=ïN,=_M,=#xM,=XzoGK=>KK$KbRKXz0NbKO2d &L&L0`2d &L&L0`2d &L&L0`2d &L&L0`2d &L&L0`2d &L&L0`2d &L&L0`2d &L&L0`2d 4A H)RT#uH#҂#]H/2 #c$2! l!r! r O~I|~rrrrIHNMST2՘jOSc%U ͩm=CԅԵԝԣԋԻoodr#(8Z8aNSʩTs8N; s8igYlqv9csùWƫyMV^ySH gy X9`1_K?, r/+?VX`5W5 sg L3 Ӏ:BP= 4&BPh M@ (4&BPh M@ (4&BPh M@5@-P (4&BPh M@ (4&BPh M@(t!`2(0zBOP =A'(zBOP =A'(zBOs:Fol6;Vۀl`;{ O?8 G p ' Ɓ=pYp \goU1A ԀMMMM%JC_pJ`pJ`pJ`pJ`pJ`~YYYYYYYYYYY-r?&(F݈7bXp#܈7bXp#܈7bXp#܈7bXp#܈7bXp#܈7bXp#܈7bXp#܈7bXp#܈7bXp#܈7bXp#܈7bXp#܈7bXp#܈7bXp#܈7bXp#܈7bXp#܈7bXp#܈7bXp#܈7bXp#܈7bXp#܈7bXp#܈7J? nĂF, nĂF, nĂF, nĂF, nĂF, nĂF, nĂF, nĂF, nĂF, nĂF, nĂF, nĂF, nĂF, nĂF, nĂF, nĂF, nĂF, nĂF, nĂF, nĂF, n Xu`76 m` wػ;9cl0 !!!uXMn1i(d14`0x>޷z}{(A(""Em{U MPs37r*1B7g3s楋. nvmt;Aw]t7C}t?=@{AzGQzmUA%UTSC-u@#=NOГ=Mг=O/ЋL^ZQUmTFlTFlTFlTFlTFlTFlTFlTFlTFlTFlTFlTFlTFlTFlOlTFlTр>6H`#6H`#6H`#6H`#6H`#6H`#6H`#6H`#6H`#6H`#6H`#6H`#6H`#6H`#6H`#6H`#6H`#6H`#6H`#6H`#6ب~ l$F l$F l$F l$F l$F l$F l$F l$F l$F l$F l$F l$F l$F l$F l$F l$F l$F l$F l$F l$F lԷǧ:N :΢:vyt>]@E.KR.+JkZFn[VMtIwtK!zG1Z}VRE55RG= 4=IO =KH/ U l$m$F l$F l$F l$F l$F l$F l$F%F C`#$6Hb#$6Hb#$6Hb#$6Hb#$6Hb#$6Hb#$6Hb#$6Hb#$6Hb#$6Hb#$6Hb#$6Hb#$6Hb#$6Hb#$6Hb#$6Hb#$6Hb#$6Hb#$6Hb#$6Hb#췑FIl$FIl$FIl$FIl$FIl$FIl$FIl$FIl$FIl$FIl$FIl$FIl$FIl$FIl$FIl$FIl$FIl$FIl$FIl$FIl$F}{| S4:Π3,:Ρsi'Gt!]Db.rjznfntNwНtMнtOzz*hVTSC-u@#=NOГ=Mг=O/ЋL^ZFFIl$FIl$FIl$FIl$FIl$FIl$FIl$Il$р>6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6RHa#6Rب~)lF )lF )lF )lF )lF )lF )lF )lF )lF )lF )lF )lF )lF )lF )lF )lF )lF )lF )lF )lF )lԷǧ:N :΢:vyt>]@E.KR.+JkZFn[VMtIwtK!zG1ZJڷ55RG= 4=IO =KH/ U)lmF )lF )lF )lF )lF )lF )lF F  C`#46Hc#46Hc#46Hc#46Hc#46Hc#46Hc#46Hc#46Hc#46Hc#46Hc#46Hc#46Hc#46Hc#46Hc#46Hc#46Hc#46Hc#46Hc#46Hc#46Hc#kFilFilFilFilFilFilFilFilFilFilFilFilFilFilFilFilFilFilFilFilF}{| S4:Π3,:Ρsi'Gt!]Db.rjznfntNwНtMнtOzz*mmC-u@#=NOГ=Mг=O/ЋL^ZFFilFilFilFilFilFilFil ilmս_VUt5imy=n񛙷vjy/ڪGQAz#= =D#(=F+TPIմo[ꨧFz')zg9z^%z^jGMw/]^Ɏ;h;h;h;h;h#[ ;hj6b#,6b#,6b#,6b#,6b#,6b#,6b#,6b#,6b#,6b#,6b#,6b#,6b#,6b#,6b#,6b#,6b#,6b#,6b#,6b#,6bzmmdFYldFYldFYldFYldFYldFYldFYldFYldFYldFYldFYldFYldFYldFYldFYldFYldFYldFYldFYldFYldQB;T:N3L:Φs\It]H..K2+*k:n&n[i7Ft'Ew=t/Gazh *ڷ4H$=EO3,=G "D/+VmdFYldFYldFYldFYldFYldFYldFYlĶFYldl4`6ra#6ra#6ra#6ra#6ra#6ra#6ra#6ra#6ra#6ra#6ra#6ra#6ra#6ra#6ra#6ra#6ra#6ra#6ra#6ra#6ԮF9l䰑F9l䰑F9l䰑F9l䰑F9l䰑F9l䰑F9l䰑F9l䰑F9l䰑F9l䰑F9l䰑F9l䰑F9l䰑F9l䰑F9l䰑F9l䰑F9l䰑F9l䰑F9l䰑F9l䰑F)Nt:Τl:ΥtOЅt. nvmt;Aw]t7C}t?=@{AzGQzV*mO8=AOS4=Cs<@/K2B{iF~9l䰑F9l䰑F9l䰑F9l䰑F9l䰑F9l䰑F9l䰑Fl%l䰑FnF6c#<6c#<6c#<6c#<6c#<6c#<6c#<6c#<6c#<6c#<6c#<6c#<6c#<6c#<6c#<6c#<6c#<6c#<6c#<6c#<6cm䱑Fyl䱑Fyl䱑Fyl䱑Fyl䱑Fyl䱑Fyl䱑Fyl䱑Fyl䱑Fyl䱑Fyl䱑Fyl䱑Fyl䱑Fyl䱑Fyl䱑Fyl䱑Fyl䱑Fyl䱑Fyl䱑Fyl䱑FylQB;T:N3L:Φs\It]H..K2+*k:n&n[i7Ft'Ew=t/Gazh *j}{!H$=EO3,=G "D/+Vm䱑﷑Fyl䱑Fyl䱑Fyl䱑Fyl䱑Fyl䱑Fyl䱑FylFyll4`6 (`6 (`6 (`6 (`6 (`6 (`6 (`6 (`6 (`6 (`6 (`6 (`6 (`6 (`6 (`6 (`6 (`6 (`6 (`6 (`6ΡFlQFlQFlQFlQFlQFlQFlQFlQFlQFlQFlQFlQFlQFlQFlQFlQFlQFlQFlQFlQF)Nt:Τl:ΥtOЅt. nvmt;Aw]t7C}t?=@{AzGQzV*:i߾8=AOS4=Cs<@/K2B{iF~lQFlQFlQFlQFlQFlQFlQFllQFaF6(b"6(b"6(b"6(b"6(b"6(b"6(b"6(b"6(b"6(b"6(b"6(b"6(b"6(b"6(b"6(b"6(b"6(b"6(b"6(b"6(bmQFElQFElQFElQFElQFElQFElQFElQFElQFElQFElQFElQFElQFElQFElQFElQFElQFElQFElQFElQFElQB;T:N3L:Φs\It]H..K2+*k:n&n[i7Ft'Ew=t/Gazh *jڷG$=EO3,=G "D/+E((b"6(b"6(b"6(b"6(b"6(b"6(b"6b`"6=Wuژ|!~[oIL M^}dMzO?i){*V_p߷d5 DӤ+Dwҟ1͓ƙMk'#;&5>M|rSǍI',/׻48ijz7TA07~͓m~yrmLqXVlۼ۲p},euYě#М -Xh/N ¾4/S8ct.!XeVSx4iMi]i~n+b8(T櫊\[K4NsC)4?^H)^Qŏ'<4X1͟.~:͟)~&7oJ4.N4-M󱚇B/B2qyH󃥇3iTii,-JsWi]ח֧yC{i~i~qHڢIȊCn:=+ 1tFV3t~<~bJGB~mU0"ֈbdzBg5_jV4iF4?QDV*O?ooMsw}w5958鳦arWnλb +4?b󳭿 ﴾謜v}r]\jM\ujMJt0kMۍmKFnQ'm;v.~-ammߤۚr{9+#`1t#ϯ9r~W=f q8Nj9B969*9Fq$cO{mRsR/>t;S.,-Cȴ/Fu*77k7?*IM%O^~[~[ww~>|]yچ/ޓߓz_~_Cy:oJ}66ur|J>%uF>#uV>+uN>'u~m0O6ʻRW+RWRh7S7iMλ]=}y:ԃԣy:J^ILչNyZ)rԘ=OOϦϧ^/^/潩//~'Nt//rr++??ǩ毦'篧4i_ff?i2Juku~븪o}C}lwUƆ4]շ%ͭ\# פ\wTè4] H \&{s[> w6|.}罫4]97|)}}4]yW}6LLt9}lXXr]vUyx9O4חNsC!͍4in+4זM#|]4JB?^^S<<&'Ϧi|ko+ߞ;|g44!Wi|O-ߗi~<>Hi%*!O"shyeRP]\*^\ST|"iTU*_IP$b]<}X661Miܿ +~£~uŸK+s>gZN$=O{wK''w*(z/D+G5SsM};5tCEwqݙgN*9;+n!H:捽4>u\K~k3RWw֥+mI3{KGR+K!Kclϖzs[J?LjuX(9Q~{vG6.3\ ٷgIٳslJRlZ6=fe9U*9﯐ͥE~LK:CJ{{ٗ?;=YhZ3Ml{=ꏻ7hHZj8sxHZ>O֨4ե)-im(U=xפXVrCZ/GuƴgTξ}+{*{:}Ui~Ҫ#~}5ZmC?B:Dy:vЩtNgЙtM¯';]MŞb(_)VMkVzZ 4x]5z財C =9/pφ9~a[6ⰗP;{k'N]Skn{u;]ݺ_Խ58a_Kb~wd>-#{Đ_=Ȉ_Qݫ]=uWkذՆ7i88qUƋ74M5<A@vZH+>ƚmIډ%gLcjPHa?,Qw|{:.sǭlֹ{:UtmMqPӪգj:[wB||/+ŝ=/LV\e(@qS\i^7%,O iio9ʬlx ϵk~ȵX IȖB /|b͛Փ6Ļ,9%WW le]6ƿOUQIova޳,6jVdEt۾oo*--K~ђҽs3֭g"W1Rċ,_J!KvK^!>S&bu!EL!]7 )bʯ"&zܒ.ZG\E|j)c6isv2V;jKE9+#v|%+D'w$!wXϧ-y[_yUQvϫj#^Vݑ[yʺ3]챞!d"ꟘcdKZ^tUV!mf-cBF 9QuBr4(Q߽ws겄,%p!"wt2gfnwUC!OYR2NH1y=+A^'+lv>bfdHrB9:B.d[}}.|! i725C-OH.]WqOqik&^9x#luOKS!7lЫgӇlƦ[5P10qJ"k &X!FBq!j R.|%T-m#"L&b]KWM٦&b^MFġniW.͗z뭃6z1z[cy{x*o=[75[B"oGM/3[v6=ݓ'-֓{)9zc>G%6׭*o}l~ }MbOzi̦GD>ɦ6>Dv2h>~M_oӏJo}hMCjblz_{t>,[^Piӣ̛G6}>Ri\e|զﭧGyO_n<Ѧ~?z|Dߦ/y6}MmӋlE^魻Uh#mz'˦' >g\¦ýŦ Ϗ$pfڱd:[~$kH4IzsS|~Kn֓u׆iThXk+c~*;WW~"Ե/_Nݪޢ$-sQEmM}R߿A(UJC,#j-c-޺SEɪ, WU[ niJdVsC&m|ZeZKдebhݲVZKY6 ]J_ kf;6?lGp(õڊ5zxxQWӌ%M׷X~on!n[.FY*7uD%Vmg,h.ķ޾yFi%#j\(QѫP>UbB:t+fUO~xǻ%kQQş}Y7K{:E 62{8{.url鳥o\]ݯ[!VW3`U偳͒?pY<7=HRQRɠAPʒU~JIk<ħ$%UJmiԭc>r3-$ԙ5iEC ;,f#0*k2:>f|9~ם4~ROM ?%aJ)sʁ)ESO)tfd6ly Tyꀩ#NԂ%YYB%M=mu/9_u۳e1]3=g 19i9cs&,Yc4#fkglQ>S;3yEfz֡~:;s9Ҝ9XP#yEGV+Vg?qZΝSxǎy#:̋W`ІjXƷ;LJlHۆI6wc&&a߀{SRjS=5bٶQo;qI@'s6F[3O%?$w/85W#;q\Z<߉lˈMVeG#&"Vq':޵(b\h޼x=8/~^"fd@Wla@ FYmxjh&zL0{yz&5bf;y^最Wl#D37G}uGBb>^o욱⫟;{lDc7-Oi#< 54-vkXȰu}m`~tsG{1G&EctvkX4h|=Xҕ$#} c4#cH.I zet[ޤ16l=;N`E,}]bW&vݤ[-VAٟt;9p9+Eu?x= zG&8oEނgޖ<<ᱼ -G%ލwyރ^xz'4zhǟU|"Ƨ1gle |Ϝ|3|g3Y ?ï&묵X Exaa"MTi)+meA/TH%mv8Nߡ94ßpu;N:N"YY<+q\t\b88nӎ[[`;~gW:dWvMVd?V.ו*_t9P\;po,wr9gy<__#E"!*/S*F^wwxy?/oLky.=1>GQ.K T. W6_E J4ߩtVGx%)ݕOJK@~VIV9%UIPe$?RF[qʳJ&d)/%G!1e2O+,RKBY!+U}j-)@Y(/ʷ)R9*-!LCVt)Ym6H4Dmj4BJ#8aI5^FiW+=&1 5EQHϩg?S,i4EQgJćJ}$IZ8|4>|IJ|}¥< Pg3]99Z969u>+}|9^ muNvN>wf9/Ӝӥ/J_; R1I麳Y*; |.v.}۱wvj߃kاz:~Ҵ1JYmM&uZeiYr}m6GnjX[,?-іʑ2mJ[cuڇrG#m}})ҾҾh_k_}or?mvDN Byv\+NhiV)OnӴ*3]KgTKj ]k Wj&jj.vMwMrp͑׸)zkzѵҵR/'w\˟1??y_Cy__c_"o)O#ʷ'Vj>])9B0CėlomNO$AQ$y}Ch_q m5:J:i A}Sԧ1b1Vz|J/>|iKgo,?ϑvD 旍J g'ӪlboI&YĒ &O$&) L%ҏ46y`>x,\9 ݍT %  ܤ?E°b7O%q|QH0I(A,*րB: 1pO('Ϥ~qJ?B4U<_7#$- ;r 8/{#cod썜7G|*H% SZ2?D0{,ۤn_-P(0<^ a>t a_;ͧKzoko{66ޖo{/mxֳAo^|? ?+%^"L?;V'Ibi[m2;Pc^02mx(70J]FQbFy,Hi4FyJ#1_cH:R8#1N4qR~c%Ɠ0diyf6 e^~y_'FmQ#FQaHv=*S0!M2KJf9`.惗 {J? 8#((@YI pVG΁RpK/&᜗(w_ sjFų|( Q$CFU%dgQȉ`L04`.AYU2 y7#< `#6R`#6Ru]9 `#6R`#gl\ҋ r\) ؿ[ :lCV@Q`4x b* 03' )a#{9Z;AҊP-'=bxf1<Y ,g3bOU*iJxZ%*<S)ǔ { O x(,^S )k5bxM1^S )Òd9,Y+ÊŰ\9V ZT9,U Jz%v^]Į^Ů^ŎcG˱bb9vX],6O `/IV{BB=,lce0Vxi`gbIdddddddddd~)re3BBB8Yάgփ3A>Ǚ-ř-ř-ř-řIh89g|Gf#!!#wF wF wF wF wF wF wF wF wF wF wF wF,,,,yp q qJ"""""pVJ"ۚᬔ"E B!44 #Ky|90///wg 9@oӈ/awQ oɏ&UWc$ô^1Z@"d̅z6 =G6}蛀7 FchY ͑B}W@qwH/v#Fꆑbvf{b8iFq9<&I`2}=Z@\=1FkHC%y!M[bS~fpﮐ'ߠG)9ǑǑ燑8̂1`,3 ̂1`,3 ̂1` @͞.t =]BOzӅ.tgslѳSCO =5SCO =5SCOM=a%Z{ɼ#T`(` H@2q͉w7'SN }3@4v6:M i~-A+<ڀh@ 1#:Xā#+n;z^1<@?XVU`5x o <X6A>lO&|Z7 | v.^?Fw=`/8P|I& |v=`/cpP?樧qhA# j~C~zᅤmSχcQ/s~Fi BA h AsO(-|A/(8$3*p(@> |\u֭֫b*֭b*֭bj!W1W154MA3p?h9E~L].h4A1 ƂPAXhP?;~Ƈ>S_?zbw(vbw(vbw(vbw(zPP _?hA#;k( 4MA3p?hnZV5xmA;D <b@G t G@W@wc7x$>/A0@?G$0$; i`xIFtf` 怹`AU2X[` xu]@yl|XKk l߀[|(?(v(]߻ oFe1`X xyN߀wA? +U짏G43#C4Ļ@ .itqz 'yGqxj;qߺN>ӿiꮑ֬~E+fX]tCx,\Oo9" R:X`X V- ւw:JL8fZM<]0az)a!_OvFDz-9d QiX0$0O`m̓y63mLS@P"+x˲nw݋#P[RZh ⮀NQ*T,h[lQ"%t: Mh:$NILS{8s>^7y߱ԘAԘAԘAԘAԘAԘAԘAԘAԘAԘAԘAԘAԘAԘNԘNԘNԘNQXaqŷZY0:F鳙6148Ƨw3737`;aaaa!WfAΉ}^Թjmoֺj PH~Kq=n2,7ш-16&ƤژTjcRmLI16&ŤTbR]LIu1.1 $ռZe/,rvSX[Bwv܁;2<ξǓR2:c2 $Rh8GhcqTqކC%hXa%hXJ~4&/q|ħi|4.ğ".ee35l\+1_Uyq Z,uXhMT|5vOK7aq2-/TycTw ގwTt\p9fk0Az֣(Gi=JQZz֣(Gi=JQZz4hgE+.ʂ,(Ȃ,( &X헍}GGGGGGGGGGGGQH",RH",ʆl(Ȇl(Ȇl(Ȇl(Ȇl(Ȇl(Ȇl(Ȇl(_dC Şkb"v0U9v  7¾ԮV:<# f-/]vOkw@_4%/Sf܊Ihca(x=&$@<|J'5#SP#RW9 R&8.ufT#tԭ>{j_^+q{Sz,Hv#Rk6p.;Н:p\(5;l;l8CKFn }x(nG(=|//H_/^k[[2ͧ o=ƫ5v9|<=nEցonYayѷ)ݱ#{E^Wd*2^
8 ""*""UP U^U멳՞cKk'=BS9Ap4ѷFjS{jF<Z+֦4 tks#SWz_7(1F1wDH,ֹcZ$Ɗ'eqNa~L+싿9G'}?|՜+z;BC  CXAX!z=F1jQ;ȿC1Qk)G(4V%Z'fǗЂ؉^Y'oo&u uiljyX!{xsឰ^*"rX4>o>o>oe2 ~#:?j~UF QCjG>v{݃ld2 -Cjː2$Ԗ!kAbHR+&$<$ Ŷy?#aAlgx2.tߎu9A{ụ}rђއp,aĐ8fM*wV/Q[c|:bu P_E$ԩDXOz sّGh"zhHo)0~N?Os<gyg]_g9#xsgUYr^[kE_?O7q(.7?q|"|YV\ןWˌ/ke`VxY}ijVhMpH!wȐCd(Y.J7;[[]p޻:_@!pSGanvCQ?O6\(.nErM Lmc{{OI7?-ZՆmbrPErY{ajwxR^ {/z'Sb0a)q"`j?1 u5lJĘo@̥ĜA5x0qRXJ,P%4Lv>EH@ 6¯pG(cp Y>gNp]sކq S}N{OU5ZeoGSf܂[}vgX(TTTU >|W;Ə4UjU~J+W/썲v}A-اdllͲp,.Lf]"˘[es2W-K˂ע7>$_zT[KmT~>6ճC5sm_ڨ{mTV[sToU6[uV٣^:c쌚QO6[Z`Z*Yfk[_UFlM(7M~>"?#-u} 7Сwrs@7ۦmS;TnQn>"֊|O2IF)/N7r\-G[b_\W{f(#6p#:6C|c r8h&/)Wwh Q;UN"UJV1 {7eԝB-bcxM5ޮoW?#lN͉$-*kiWMwYsئ"Q}/R{ ئm*` Fٽ^צҵhYU,T*֢`Yl SکZTSrSԢ:N;U;\ZTjUSe-̯i~M˖:>]ǧdDUTb_,UX&⫢|(_)W2Q^UQR鵎NDAZUzDAzI'M4}zDA|FiNVEJ{i6>n,쀵ãbsw6pgY?Y6ȪuXk;`u-VuXQ[QVo5Vblt'=i'=)I}4Q[=mZ=ʞiVVZ bS˴'=9yZ {z˞zzmGح^/eONqw[bֹjp0/~qt޸r>IYmowh\I5?dΚicg&IPӜUa=v{ջtG9~+WxԗzLF"UgW8LtMz7W5y4^U#TsB*ϏTays='MtS͵Zũ_ )q|:?T_U':Y֏~d/. o|#V:avcFX6ӶҷL֝g=%O۲'=!n|/~yږiۡpp|N펷֣ ,/Gg:.<`Z*J5=fMQlb71~]>Q^灟O#o鷮L7~M4o鷞L25=f7Q(MQܓxbxAO{^tƝָӕÿao@\C/ h86x/q'LZ;k;g;n ;ϋSMnuSRu7ntSF75MnJtS TB76Wظ6ngv6n7֢n;{* [^1Y"p;[eIΎW a;-3_ΈVFp9h =aey `-!7mZ''8~|C0Gq>$>O3,p!/ ̊NԄ/&A-ηeuom M:&dʞdʞdʞtNIO*f!\*,] ׭uaSOYaSg<|ŰK$V/V>g#+ɱ:9:''OAIЀ#p$8#a+^_ǎk/&Cr1akt,TxL #g=c|t 3. E"蚰*ZkaqX#׈5yh^3;aěq nwv܁;q=x^ҎuR'^Ac/>[P)HDw,СcM?x˸_ \9E"zs}{+LMt{h w<c hƋx -؊ъ6lvdЎ,z5aAMx!:Q(zub:^X?/NGPcCԾ[^mW ~\~zx_t͗pIX_k qmȷzӨF4Oqz'@z:ӡrm\ 6ȵ rB>wGOy~{$ԡ1 $BG4,K1@l1>[ώ0Gsq>'jnķpÿ;ѯb]̣w]ãkxt jR^]ʫKyu).>?x?!Ə0~5x')bg96 GG΍>I\"̏}w>+,WƮJ3_ ט>59 [IvSo]yG5f|kq_tk'.XR\@^Q/L9q;2hGv a: )ڗj͒IGvQX3i_P_/Kԗ9EG!8g9uq<)s>aDX~,Q? ԏ:Tb^A^v8X-iKEG_eXqpaٴ'^wU쁘9wɜd~ R_~׏\ɠё 퓏Tqކq uN:43p&ޅץ K_B =qq"+7@$MB$MB$MV|+p؛w.܍{p/V>|X>C|Kq=nmM~;);)֙Τu&3iILZg:֙Τ5&1iIkLZc֘GG1 $ՇXeң^b UjRRYJ5ԢjO1!gșr& gșr& gșr*߱*߱&I`( &I`( &I`(3Uəkl\+1_Uy,u:WEUQ窦Ti4tj:M5M 4&TӄjPMiB5M }Sw;N}Sw;kI*IoI-%ߒ[KoI-%Ty??7EGğ^oOtx|uI:ݙdtk.R\JKr)].˥t.R\$]0ILt$]0ILt$]0ILt$]xo(M\=|c~4s9;+mߕJ ]4&tф.EhBM ]4&tф9d,3K̒9d,3K̒9d,3K̒94+E1CxrBg^3/ҙgy_/kev 9]B.!O7rv 9|N>s5M&}kMJu& xSv9;EΎ"tE"Wwkߎ3.gAș Ru4kב3!L3!04141411~6kȘ$2u? 92M{α5M:֍FSMGđ1qdi{'텟4d쇟N_%%}Aɾd_iJyؾd_P23̫P2. JWz-꿎0jޡޡdPw(p&=DT< L= D~d?Q2-2%LA'WLBLB {EޢdoQ([LHLHLHLHwAWMM55=ljzشȴ4ϴiii)agY{~^?kgY{~^?kϚ2+cʘ2+cʘ2+cʘ2+cʘ2HHO(_u~).ޛ5l\ & -cBL^;+c׮ ON~GQ)Q4¶)džNݙGQg'DcuX񈺺=U<@EUZ9@A]E֛CP>@n! &WILL $o]]]SUOy{f" Ebp>EA?PfGA|,>|,>|,>|,>|,>|,>|,>+Y| }CkZW5Zq?qQ\Sե5YsU0Spj j8HZbHbJ?)kPa~lݨ93H-}T=E}%=ָSP?yZ 3vE/P ᩙz}'yZ*a_ s&GHz d}w9ێGXϔ粒ߨo%N_r8ZneE+jYO CM_*5_s~U:D Z4_jV)TѲV%~^o]"l=I\0(A zzHqsD{.`!X\P(:!=Nzs,:yv:=qhC{$')`*@vٝo #= f`^r&l[v禁z b (=COtop"g9n:;L/ؑy b_ ?gs`Jy_aU84K"M z{aG{y C0')4x#90 σmƀX0NOsgs<.`O x< G10<`x< Og0S)g3HF᧌'1 "Po((rչa8[>;;:[887cƱؿq8o7cƱؿq8o7^-^-^cy}(^¯؛q͢p&R=s$6\lʹ]X^k@ GX\HV7Yױdq"PQcј@}%5CtP3yy!,34j*nx=@/4;cOlȱ;.p7 `9999999999/bX[)VVL>cݮh-m ƚ-:3=?n.7溫^W:_=#Q#ıgaLGڝEGzhNs[AXMT xhz16rN? G.%PHE,RI'E+`Ql( 6j =Q6c瓋28KKKKKKK}K. D2S\S|E4TpVOp3m%>KoDbGRVr}NQQcQ27D[)Pb6ZQ8 ]땈[LL}>R{%ms Kz wQ3Ig&f617vQ_ [La7A RK%ɊN%Zf&sRkt RDOTJ uk R)%A) Mݎ]L59 S2Sb2䓻 {Ō /Ewq w#K>%yUQxk)y72;XEȑBku1VA,RP_S(̠r)cbSDǤ5Bƃ68X;mC+H3En|EΦ\k\ky;Z΢ڒc;ķ39ÇQ65DMAY͉oA|+ߎxaAR5ee *;Fh|\E͑O"$*%[ķ%M;@(%YJ fP w-vZ2!̍)77fAނ-ޚmk\@hcӐrmȐwe3ܜ4-HӒ@kҴ!M[Ҵ'MV`|ӯE&r=92#֜5=2!P٩~NJ2N(NI-E6NB/: wOvJ`QuR Zt`ƌctƬ aն'V;WJjZZX%%=aڹv8Q nGkakaZg;3999ny;z$ :+vvs[%iZ֜!][ҵ#]{u@kxn>>W gh c3-4!z?[WǬ9^UV\'cy6Tw^R}nRĖM,?xӬD ._ +j8@Wբ.$ =JŧX?;y>'T^ײ_:V%pukn5lO(o?QԐԲǍt{@r|fWT5^{Jȧ5ɸGϤJ_zUlSׁ<ƃg0}whUzVn %,9N%_>(_^V\Xi^D?U_/prMB?PQ .@"^\i+i&4$tVbMFGQByzue/kc|WsbN˭tJg_[lL酌P sc fbeuV2r2 އ~`j NVݼ}*XO6zQM ]ɝbX=N'€9}ur-%ZjSKيf];;nN$F#TF#}>K˛Kez'RT4?墑̗\65zF_}6@j0DCt%&*g=>=\WW构B;nN ^j]m.xjonnVFoffhD{{ 3!|8ݳ9=GscaO -a3[̖E̽9Ɯ.ZWznh^,ofQ}3,f˽4po#vv!njýdEiOw2bfY̽I3}zuPw(1a'͓3ČpG Hw$1O '@뎥q8Rw;oowI9ٝLLq s2gh;E'݅n.-q-e d[H]kܵ-'׻q-vq [Hm6ⷻۑdw(-RT4pw=&ȫ]6aM&a {؄=l6l0A !Nv) 8EpJ"YY?0HĢDz2B,#2+DRdU"W,/j_(k5_O8I_f4̈́[EFwq/Q?k8 bol#2`1O4c0EIb)րXMdn5%MX kkI9b !}X[pp1^c/kLl %Wb HPXI0>ʰa6Ix< :'Ohl1O@%><8\*gxPlhx0``#à 61Aex0*Ã<8p>>%^CzY"klXalzL 56ܗR8N=˳JU"~@dF"`A6<%OD0NI7Dt,0v;`R?bJԃM\fx$H& A8`FF #3,֌)hE wdH7QpGqP~g'Y!w.G#B;eEʥX/.3q못V77z1W )7{?JP5wkNW MPަK^])ޞKm߇MޏWS^8l};Xn pjܰEy81zz>_L`uz~X7.3CM k^q|*U ]է"xZYZ1m=p3Lu + e˟Xj(%c]7z)fÃU֟UJ<決4[۲T7f UgO=]R0GSɫ2+%̺O=]m೹U2&Emz2CAAs,6 NB'CZ}fw2R Cg A0',,Qfþߦx",J_TY*;h]{iM>f^\~V,Be~e7uwDRga+l $4Ld3UJw[)oJ/ }ʬ~Y`qVz+kkq дl_J֜Z5(@/LܣC)SLb-Jeo1ʫY=_c.3=T|oZ[姸 5KbZT_co?0O6[ExY 9Iwyʵ/~^#Lx>&xS&%ŭ]0m1%uLɲ_eЫY ȘFm k]Wl M*<}II6}NO i;`I@wp6XCG;QW~l_8)Ӗo8q@{$Yzϫo!朹bt%ûC*\ɿ<{ޘm)h/ym/ѓtwd\re[*۸u?[:^ŪwX^F̽uu䀔O~[z:RLu(T ,L9pVϖ3!ǁh#vO~2geEf 3Tډ*ei^'S,87m"nN5-/]`֎KVvOn_}8[V]3ɓjK{zٯk|aow&*ߗe߶}cȺ~Wƺ?w<(׬H̹`l'Y5Ob~}z,kHQGo9OgUsQ-/Y2wb< *=seת"UNSxz~UO.X*X{TEWk__uxSH1O%)?7ao:onr yVVJn}K2CdoYQꉓs[lK}!Ֆ7B6E#l5I˒sMv$UuO}~M`~7}~%X́{G'{|5?ũfޑI1ބ= htq3?;h}<8Sdk%Q}O:3!4~Uշ&)wSvpw>Kt4ϜҽL\}#* ;˾_+yկ=:imx~DEb$z G׾j|j-+򜊑^/*u(}Y{ M8 ߳ɻ cYM'O/1_nN)?ٙN=&ͽü[Υ@Sl}hkpoh uWfJhޖfZ֤)0qY93~wz_/?rެ(."(4\Hb&r~'X@@G+U|ou;92Yg37?0 RշںԜJ"F@`'m2綹 r' sq8E8T§8$.M\Oʿřk.\1b]$YWa֍֍)uxc=*FZblF) bĚ%ˎ)LjdgY̕92G̓LyX(o\y[('R9N59A:9INT9MgsQ~-r"69W;@T]*]eR2VY*jmT[rUuNH+QX1YoIV:YleiVMu2Uu|WjlG#iV7{{uu(Xׅo]JշneX7[ZnZZa Cku ֽMMCn'd q\';֋Nzi49?X㝣iαtyZ<<&-g3Tp rv3-=%gLs^q^xyߙ*:ӝOe KY$qr\yIvv ugS*Oq+幮붔ݣMqqr'=)ϕzQ/*y/˔z&!LZy#^{|;;T~/zNrww|;,NNO{'{yggssh<|޻*_../{{7ȱ߽W^o/W 7{x9 oyCar|{%^%'yr7MN>ʯB["zy^\6"oUnvx;O-3lmYv;)+$\--Up*3|XuPEѪeU}iw?O>+|>7E$|::|K6ule:!ra:%3Sy8:+q+ukd~Guwdid/3^FDߏNS3|ׯOW_o*m.}Ў!vC?n??e7_[//ۇw)vg##;ǟOO?Ogy}d_/n{bؗ=h_{ܾ:6<ӱgG@Gu{3s$'Rw+)H#\E."""4RJ)RD"bDE"奼ȥHKSD."r)"L,zzf<}L&aԾWlTӍѨ`l1W?ϯcuY&KPp|uIt簞5Vp8UBB=,0 Pt.SrQ1T1P1GcՓꇺi8}IQCg6a/kϢ6jlT+Y3IG zI>RDB-D8Z !Tqu9Au9Au9<J`)i{>JmBH+XVZC!-1_<8(d-mV˨)h5SM.SMH5AQ9fyY7]ކ***oC_V.=oC?w}+}+}'ܺZTUU/ Y:I'$B}:?V<`!q`U^t\-Jв988k0PTwx `NN~kտ__ѯcyﱁ 7 6OX3N~~/KsŹ4q@z6XcqqNLF )'NyWySoS 2)!ӫ2>SY;wFIVIyQ)Tp2Iep+ʟYr g7oI`%ȃLC<Č<#?ʣX1qI&yiŽ<|1 ءۙ0w2?$^H4O]>'cY;ƿ| ͆/qTe> __<`sa!_ƿj"w::,q3 `1,Ży7K `/j5W8+|-|={|KkVס[9>|߆o!##켃W{x]|7f_}Ke@"adock<Ə;?9w O9'YeY~Z0 V^>.K'' 7n|?soAcXShRCf24`fY`cqP >=b`BȄ QV2 1713aH`NҐՔl҆!{ /Z2p/S@`&( f`&( fb͂I0‚XQ0fjgu:@NȀ09 '9 OO N~s@QX B 99 Յȃ|@T-[,PW`%UyYŧN]~^AZȀX -(H ҂Tk5_u!HH(U=T%UIl 0fjUŪkUFh]ߪzWՀLXXȒUT=JU"?jKU5W5pʄ\e],U\VY!ᙀ`;( `;( `;(؎U cm`Y}QW?Qգ?Y$1cY ?dQ߯ފ9?5rM3{PP Uz7 d@(()S̢1iӬ6^ZhaNm69je:mψ'k1))̙MkG輓@\D\ 9'o Oa~g0_x'Qx bÈ[ HlDl=y_Ɨ)ɿ 'b.U|D̃:)X97&bķ_%'>.|'V J%?Jޅ?+s%ov V%sD%~\$JL!J.%%?DpUq2qq~ 2.@ &n'&llqD&~88dPAw mSt^b .buEL.bEluSbi^b .bRE5Sf"P1)EXu.buE)E)uSXuSX"L]"VG]Ě"P:"E]?La?)?a a a SXS#?Q֟}aQ.L(AúPfgy87LdU>ASCj~#F>ߒQj=D%fTx0CNaPQ6\PGLIRG!<>ϴQ?3QUNtLŽ1_Tgbէ%K|U}B-ԛJ-ԛJ==S0DI:EAOmȈ.>2RTی`z zנz j\=qA]Sk2;917syF7Ж}}%wz ,F+Yv bѹC -Թ0D }ԹC F[_ڒ@ƤI7,ݒ>dz#Yb\VdΪ`5V#X<Ͳ ߕu*fe43+T~ɬF| f3vDZ>e| xxxxNKfUQNp"$ǾɖEpvpgGTޕ4:I~QISYiH+jY?~-}J i6KҗK/H/___&-YoYLZ [ҋ7+AH/J/(Ygi={Ji3%^U#yCgGA!y'1>N6IO3esrko?SGmmq~;%g+,?+]*HM~_KصW  N5XZnl&3K}yc vos1}>?~.35l&)dJH0hi4ti"ti:ti.TZ`ZlZf663m4m1m75MgMLML7wzs< uPg@S< niUc㑙djam]h^]n^ 5M]нc3s拤WHCoYSk `iZ-.hUd,EP(Xd4LEU P֗Nn>Aq)K=ŧ*UFh#Vc Alì]q։)Yֹֹb7벾Lu=u֍-b?d=j=a=m=ke57wZ--ZNi-Zh2ea˒t%tMMhղx-Iݍ[Nkrz˭jc6l &" Ơ[:6:6 :6:6 *Vʹͱͷ--mmm#Azvkc;ojvٮڍFfb{e{tˮҪqLOOϲυ./.wCE~}}}}Ǿ~~~~~~25MiQ w UryG11111 :11tccccc tcTd+ñ˱qq2~q:N:@wӋ+[NFNmrZ.gsfEP(XSssssss͹/¹ Td687;9w:w;q)gTW7]Ku]f\.۽ AsuAGA'@YŮenj׺Ѝ-nHvWkk{Ye5Mn#)hvw't{$t{N*[iX=.?1OZ 򌅊U<=<3=s<=G)_NM---AɷƷշsɷ˷zowwwwwT/c[~~o[.⌿(^PJ ]_ ]_ZZf6Nn>#S^y%U mwJh@5`6'&Hs2#0,%$0:0. Xle ,.,nqV6ZnI RN(5Ӂz%p9p-p>Xi @AG3o0Lw>3!)ޓ($ qgA. .5M!\pWpoauQgǂ'gD /o{!B 5 BP&T 2Ɔ&.&fb̙ZZZZZ::b2)teFT7t>t)t5tekvˮVFpcr5 V {!p" a oGDž'(³s ‹^}d o$    ___ ߉#ՑȀ90~T8B)H$epc$ivFو&"c"###"S#3"#" #K"#+LȦ Dv<]1j@䰹b3ˑsۑ+[ֹQֹ-QEm6AQWhyG4`E3btHthGQѱ϶c^tBtvtZtttNt~tQtitEtU0kۢ;Et_`(=^hoKW]7Hojc  ybX/ΑWdžvg]IĦfYAűűe Vߧཹ-Bz*_!ء Y(\]Pk&~c7IT4WEA .;xeW<Ϸ]3y= %>1[I8P=<>5>l K<ʼn___]??????R,Q/%DC&ք+HD;,1$141"18IL{F'&'%f&$'%MHrXؐXq%yg%vz'&v'%2s{6qGK$Nyq'.a ʼnI¾IIU_IϜlL6{.%mIE2tH&d9ّ%"[]S*3!9=9 M.gnrqrt[Suɍ-ɞQ%O>gג7D OhORŔ^h%&!5Ԝr|H*YLTg%U8 REM OLpEj|U}IA_%3RGSR AԒ E;?TljoMj} jkjGMJMéc3)"ԕ)~T MSZg7NtSښv9c|ٓyz,;oJLNO/H/Mp;ҫkқ;ӻGǡҽK99wg郙LsƖdB͙D&)g:22]љq鎩ٙ)Yәře̺̖vLzfOfPhDtlBr;8쀬9 מl.glgvxv$1I٩yم%ٕ5M٭]ٽcj?= EN)g+./{e^ނYcNWNN5r֜+ŲKL\ƾ%W ,57⮟x(g]rcMWM7yaŮl{t}{n[[[[\$ށ܆ Gv:vNzs+~0w)w5w#wUnU[[[mPk:%5Gnz>eq֎k;nOo:uJY}\ZpϪuuJLuKv֞=p[8iֳΙZ/C 3h;_Νys#*3OSy;#c"S3\=yЅ%CN}ɯ!]o_:%5ٛߕcE*瑨]5U`^ UW!P E) C C #„´œ|ZTtEU ͅm݅}&Q?zwjY8E W 7 rQn,bch+zb4'd\VBaŮ*+N,N)N/*-.(...+vW7B{D,!_X>R>^>U-/_*_-(n6c[#Vۧіh˵:چun6mJYms-?*qgs2|Ӑ~̽ɯծf%$J*+ZMJ2$d|%4 +kܙ~yy9}܏`Js ,.X^JƷ`]l-Q`~ׂC-8Ypڌ]ʘKk,erb-4m:zz5I Ɋ tTlllB8656#6+6_EƖVV[Ttl[<'v v8v,V;05v!n}q<ooύ)immSǕDkg"ާaj_|`ȴxsx}E|v|A;+k;{G GrO쉟_LعDjnvn"&MyvDa{WaZ-4ߜC$F&$K$YJbܢ$'9Feɛ+Vhf 1317h X.1I|hZXױO&ؘd`DbGU_MCԟ888/c,Rwh{Hk[4nvմ7x5Ox}W}>쀤id(LA:l_̐<"Ygٷ% B۫ М_ u UpV pj^׸7RqNںM}#ZC{S%ݠ)"`l =EAZy<-_ck,`WHZw^;4FK{ie6Fr<bkhJdEBJ[[-緂Sy`ÑSdgb$1n=AL9[5=Z%}$fȊSw5(T]@W{PZ T]Gƻe26V#pwvOݷli*.`gVݥ9 {6l'E{J\ ڲdg8t0$BoCx}BoaCA}:mM[EBmZ_=ERW $(d,FBNDۓтu+j3/v7(o:'cgOc˨+V6{9llYCu^wZ?J `?2z~2jV/(TUsI7z˽>v;(pIԺCnpZoLƿjQyNq| >m0}<7M{$O,T Uh(E=34$PZR$YWcBZn`,i.xg.xZ3]XB5//* 3UD\B|k8Bo`iK'5.3s~mD~ CO.YY᙮x5_Cr~~OJN y.X,7pp]oDI琴E!<`W;%?džCIHz7 ԜO>]m8m/u{_IJ>V=`C%#>ۦ[$T_2B\Vm3m3{ke 拗~ۤ9&lH;!uT։$GPGd-Fj1v{qsbԬݢz CI婴Kҋ(z_$WERY˨Z'RuG+e</3Ye^xcZ쐤s̑̐-2.mgQwhBAn=4dI]瀇~+6eԲ% vǰwon񌳏9y#c|8 Z<%S%X~-O,]ÇZfM* BO G~Ah2Qht6Þxx0e^(3|f X|Pz9`-ÑvA`Y;K95pYqXc> U&5"@r^>!2*mCg'f^eOKNS8u$'G_WG6 { EweZ OKxJz_0gUd 2x+OO~#bG8:v jQ2"p3W_:P5rv/x 28yG&C/Tg_19Ĩ.o#ѿ7rWpn2#̫&p4Z/ N+UF"GݮhXOhh0kc#g9ýkc̴c~ <%}H iٹ43.F^$0vQSiC5 A u[BMXC<4C8nd :bA-C',F%2N#;["O;Ñߢg =f¿~*sSNEstT΅ O*zߊ|J=l-Ć~h͍Edf0"yin-ͬ8d:|e;Le{'~~r2P2ltFzG'' o`ɣ>&j'#YQrW^TGKc3C:&nDzUV 78; ה_%g˷i:%Kߍ4Ja{dkÞXYNjÞq$?dde#s֍H.^h EO1z364ê/v5rE&>(]s-SY,8'Ci<4 +O~޹R|l n˽ה9; 77tBwN;~tdb }]#p#fohv4wִpCƶWz')dk}m; ߤP$"k;T)}~8¹ *Wj 0ZGSʖ7_53zlNׄVRj=͕e<1;3A-d쒫Ȧ3sGխ'__2(rvp KdSةkyV~+D[yZ#.4˕;tv/$w>~LބёgdD$lRch{ =_gI>̂{8sBÞܺ%i%| qwZ7_GɂnW7 -P]PW%ỹoN70?\^hj"[c0VIVLT/ "4_Ć"x0f珹r+8PZFLdtsEC?apz"9I{VlHr<`g7=Cg(OðQν|{YXf]:,Q]M o26rz*}!F?O.ڃt3NM%16 -a?ރl4On8w,vd~ x^E7vAm=z߉MQ?Uem_W ۯe{.{7ˣ򫢎9A@Ĝ*,#et nb 7ΚhMYYVZi6XNku:bNY笋V VMTsgSjKM]+oGڽpg]yɼĝ(@8YWjw&uyKȜ2Y }Z,&2;>e*7Yܬ`ry|ipfs#/䷝z$=F_kZwZͭV'+*nn~jg [C֣qIy~#x fg}l}b}jXZz -RT-UG]x4PǤQ;R]jԽjzP=FVjzBMPTzZFMQ,Z^WZA6-{9IjSRRۤvHOL;^ovOV~ֶ4Vj:iP]UOՇO[T S#hmD5YRLjک#^+E۶SvOζO;;._eo!W|%i??)tM3Ӟ5.r5ZnZ{^Cl}JV vv%oivYr#%Bju--ܱtg#k4\> mC6xJNyL#'lw4&D UL-8;'^]<#@O!f}zpz:‘or:BuNv~X+絅cloyzѹ-Eo̔(,%=uW@;@$mܗs1#O%i'5,/a*Զm[v ˶TIuY~ߏ;LHJx]&2%ɛL]Pxnzش iRDfjڌYi-I["i6-'@o)"s,"lڅtku 7Ho[ȴMHS>(Ӌ҇2"}4x\ҟK 4}eEe ӷKٙ7`(/mnh,}.ԟoK4YC|'(j^^Ne-)(?tU9?I9?pKɨȢ4ȡhC=2zg18chʨ2L͘Y)2dX}EY骲-'w.3eTd\X_U_^w(Ɓ@@ȳNDk'Ow*EaW1ZqɁiߩ<X()+k<_ˆfqf98ǟ3o+u3gfg64fn2Ÿ3[{C@1W2dN̜{EY&_kbe2e.\U2en<̑ǵzL}5sGͻ2_nĒC:赟yĀ̓Ub7dgץ2V`-nGӂ`VQ0'"^``Lҷ````_'CÃceNuegTwpEp">Ibl +gBV_|})> 5dr? 5Oϡ`PP[NDk;5cԉ=%M7mqF^ceoa {dz7/~~,{p^K=7؁ƥϖ[&Khb)){$zolb'%4Yާ4 )ԑ}n)51Ks TZZ _ǏІ^òn::::((lSY:.%z$΅ؔ\#2^Wod|:nᨌy8;ܤn w…^H '.>޷Š]8^}Lfx\?źOcPu*N^+%>VȢGd3AxRf~xJxzxfxmd% / /cVxyxUx]xcuOyGP(i FjI\.//Ey+_9X;? y˜t.=gv'E&oBgtAN1CCy/4 &6f-ԺXArȋ; YphWvmz=^  y<36lސ/Y20}飽:YfLvL|ԝ ތ>x'x'uϲ U&N.L4d9!z.15#n"ꎣ8,|=zǼHMi77!V\CܸGhz^F =Y p]0m,R7>G:邞.:63nCh{I| qE͍!;ع>D2I["*-{X/>֋LJq4D~%XYCJ)J>⶯Y_W4OӴrh~fgc3ab}l]vW?//Daq΀Ϡ?v{a={'u3f3 < Lē;f̍;h#{?}a{eDRu}ui5mcbD~|h3h|;v4S}>O'!? c?]\ڂۢg*zY6flFQ`<;c'01 ԽY.ډ A0jMA&Y21e d>2Fh]Jarؿ{2~d`h=!94lɚl538 myDHKRNB;f A/G,ur4-KLf\e詅Z蟍\փ#(8 ƷurE_1:_W2U~Nl"=i1z >CEX^^66y9oұZ-:5}[ak }7v޵[;xou⊷wܚ7vkչwtݜ55olw'qwg5fG=WҭUjijژuAT䧇jkKƪ XMU3 "DPg8eڦʓ=: uV]-g׶vc;Wv[|,ga{.Z^~do!;/slLޯc;5z- PoPX=7c}#)vEK;/-yX{1-4?xXx&4KEZ(r#FCtԙ[0U>~7_ڀ8x%#ECyNo~M wZAޗAfn%5o5^VLՓM/V@VpVL:y]ônƕWx[o:f*Ov*_Rӫ^U;,+#` V\ދXp*OB 1?o Kjy:`mpWL͑%tOӨێmw_yI\7=5OԶR5oYsէ_@ K?58+>\3Lejժ:NT(*̊D'"DDtbU ԪZZjϪNf=LB{{yyn0#RKaˀkiE66&ԙ'A#̈́S3 ƱN~l7$}:N^7Cb"cIecdtyAi؅誸"M>hʭ'MsmETc#rH]wmdb_| 1!ݺHE|H}tjs|8S~4GSwlE|\dH|b<^XѺ 8BM| u(Jo`\8)3x^!]+tbtWJD~lp"EKO&%:NSNE7%$DO }& +G4O0Z.r$1蕉DJL̦~YXXXXO>O']@nIl#+V&%!]K)GYO MHNMN3NlJ2Ƨsے:YG%DSN$ɮ~Tc#^dg.&?-LJ&&'ճSHrzri(YH:plU s[;h0r@"KVr|TyK%6%F;Ʀ'%7$7'%wXBt }d&KNҸIH=[3s =?ٟ$ 6M [sMO;ߙGB/b$c"~W'd-c8ǑfL'^rTr_YWD ~5"[.4'U<8_Fg_EzYJ=vԯ\F6kld_o:Od{IRq&Z'e+:8&eQ9?'S.#ձ'%[_%8gdNh4&FO {NPsFw%䌤>O:2 V&sJs$9)˙35%*gfy9 sTźuybhΪZʽj9gSXeΎ]9{s cԕӑ׍N3Lp֐{B|fM~J`'S}NOcq Y,_!ufBj b[ A85ti ϰ++OQ;W kJkЮe+[ZTۣ-і]Yzj2yH5_ ?Le{ @ z$t2hJ g&i;s9[MSn<(\Gs22mg9<'}? J9x.A-(C{9Hu'ܣ-$hxFۀZr@QhůQZuN3&PƆ3{6g1,FM_a`Քk5#e`pGO!f`[k 6l`溛`1-zsZD[ymkM @k@f2tnE- 100`\30@9AE a X` illl1<#7 N5g7AE1\ e-v.-}d 2ס# JʆZL0UM`f3&G\\>WZ&5vgی4v,wn/tcё~;#Yu~qI Ȍ_3x|:pzQF{Vܦw b_ ;#2%}ks^{N޼"y2"K0`00Qy'3s,93 ƒ(_SԤL?en̫4uuIi ~Wʜ2)Y0h://mVgͯsldA53_^5ر2Xp5lj:5] {Fܯ\(Gv+u\_ԙG*u^[O0?"sOc"'ns>-S7ُBN?O>ٟ|Z/-'Odc@{iMOk|^r</?YOk|j7?'9ϖ|Z/X|jo*LKn׊IDw]^nʧO>ם94ni}Oȷ1v_3W-P@ZZS@k hMSЍ-5M㤀6)uYW񂱒`p X9sv~OxxL|ďL|kLGm$F[$^EO$D=$~C1$BKHW|H׏Nx_x􈆈w|vxꉯ lĿmSo12+T1^0?pj1,ɂ")"("({"^'o">&]"~%Qb|Id@9"!bA b|@o2(W<4wgt78ăC|7&!a<2ya|.Baa|+U!I!>{~cB|%ijR#Po4i/Aw05nh_ ~`ėP<MA<x@<'Y >M ~A k) >;~#@| Lv˞_ɮ~/;e7c_.}PmV)t&J:ЅП ,(,TĊ[ J%|@Vq'UɺYggT=оC}̭pT7n~w[~/P;c.B}S򷩙.j_ϭ4%@Йwֵ@! F#HPNPA0`A5\ 1`#u{$8Bpܔy*3z俨k ݍn̕ ڑԕwId$CП`qJyHR^F0`uf&G` rU>ɿ`.7mJA`/;^\?5#,?2ɾi~2t7‹]/<44Ao{m._Ҟnϲ {`o;>}>fsI8Nk9%No`3S#;4g٩9sb2Ys6:[NG)s޹Znݔ[s;]br#Rw[Nv"[tg܅wʭw7[.w}DŽCp=힥&=Q 6^{B1hr:x qfĻu{>e.v_A| ro7ćO z6{QTQ<_yOoހ*݃Ϧ#kK3[(c?pkܻ|zy#4__VKtOLMoY>p[O>ÿG?|?#.y_utT}kN@fu=[ԍaoE~(4\@䟋wCJC#'t89/B>BDfe #D:o!p+8tC3s qQbyoo~ xBR N,]O#q8`OG %O>WW? \8p5O/~x13(k9s\ "o U / :jR v㓂}Lߴ2մ)r Pv3 ɓ/42/~_,]rF[G_E(%W_C|%SXYd\ҍ+j=\uЃRڪ'(SzGՑzrQ/S/0.^ |p.8GxLeIU u:T?<'AYx1ȳ9PjW/_F@(ooR!J?gz`z6x׋BG C5U;n ISH+iʟR):?^'I30e0p%j'4c4bk_~HF# oogL0ҁhp, -TSM_O7@4i-K`kw^d?Z'x n7醴 _jgqs#-j݀6*VM^Q"XunLYxWbHY𳫥5^]TPpQtn)5ˎ-GvCCfUk!^55 r_6MUI߬dދo ㍿d.9nr7*J/{,gx55 lɟ{k:V}WW<" ٴ?mQ9fl0/fϢg$=!!C?־G9z^SBU=|GgŪ^kT^ns߮;h8gZ#G1'c)~S_llz 3*kzS P,ҋiJ]LiEge:zZ>GR@jy$BOOgI0F|Qo7Q_ׯS7t ʿEos²(cuN@q:q,YI`Y$ K$#xTÐx2KaH<kH< !qSϲv!Vu: YG (z1Q˒oXi~^?OmYgu@Q~ܓ{r@rBa݇F/%hj3p%I>@Z9S[Py?9GUA۩A5H U#Uנ5qYf$C?!OGi{xH1ն=j;֟w*軨{TڍdI_A_Fu=[#_?@~a#O-}zzZ}zgK TR7S$哱٪,ߡ&t; 6ԚcͷYKjklmvZ}u:i[ h6sv[.Kv?{=Ncd=.+ҧ3j{^l/k5:{n{A}>eˉ8r vNGSt g3)u;edgStf;qgYE:뭵&grr:8r9휽ڵw1Wn^n_w;QXw5ߝNq+>w;ǝ.r+5cyfw=ݖmrepܓn={!=#_sy /AMz춙kܦrgx"6*xý޸kpLG<_A0W_}+R7+v^M $.s ZmjFSb-Zcwd IWD6Fjy&bz~{j5Bug_dF7͘ld c2])YHHNg*e=e}f<޻סWpv9KM@\?ޅÌF^=7E[{f.Z9&w0kSyxgц$܆v?~0)4-G+_ߺ6.gTeI.7H6+olVfhN˟%;SBp)fۓ:!--gbQ\m]!Y ?:FS{uShk85JJU;lz;CKiYdz,itָZz+oV@qY_H2L4Q&QceB%Qź;鍒nF4:V2T 3666Vcm30bm0Ƕûx7i~5:jXYWqSLwf̡|gYAbk fgNv9(vҩw9sr=7溭ݶ(-rK(6Bx8hqDܭ F9gڝK95[\w`;Js R{=q;'݋y'H1Oku$B<4Ao7z (6ٛUy3*byBo ro{ʫ{z;]^QN{gw Ct4ڗ.p 6N])#˭%G9Kq_5uxlxBxURóHj"f|x33` #8\U9 \kgCDE<ĕɍvE:D:7sFTX̩P\k Uu1'AU9P2w\` 8g鉴FO8ۉOqj+HRy8i|t蠳6:uМ4]]rFj^& 3p;H;g4eҢ&)MgIGH p_icmXL oKeĎ sN{]e;.e8E"CCxnߋTzC54l\aT-j=ب;!Lvպ'c-F*vw#:0F%3",cSB72r".[VNpz[#!=DO%Bu#{ 9nA 5ޘ[8>. {h17P S4$&'Wv^؍  (({5R) Q`$Kt^)ZJ$ReB~hPh쵰VsG>1lAYB,_8{ 'v9l%s"?eaic8 'rش֝SbzɱiM[߮CT2;ݠZX\ S"*sySwcg-k>+45ˤplfش;;ׇuV=YԤ%9jmw[!oZn[nX;jyoȔ }{}.OUio~+}+3cV (7ְ0Y^by=1Ԯ:]R[ꋖS:Ѩ:R:L[}ܸz[55뚎gZcֻZ3#UvFsJY5vfVHo3TGvJZ!RߣFi[xuhjmCp_ՠx}pC~S=\mF-ԩ~iWm;)E-=gNӭ~n7ͩU ߖqZ4j& #v?fuh~=en5?qڦ(]jiYW_@5SRYmQM* ijV],;v}K?&*[f|< ~Z]cfnu#^갸b,UvJFȫ5>AUZ[Z |=G}n&IvrktsDy̅9kRrhqY렕jZ7BiC(m6^MѦkymkmM۩jGt]/ԣzJ/FzSZow;]z/>@ۦև#Ǡ>AOgsb}®-v}G߯b*XYN@mQd [hm5qߌF/$@2ʲ?d0n1,1Pmc 'F.8cv2qx^Z;=Sꪪ?ݫ2${ܷ̃9- 5 pYo0r ҤN(ttudc1^ǫIX]Ý w $r]udE[{9坋ٚnLY8rܗRúF-蠦o@F@Gv']UU#+bO%ݏ|JvJjF(5m7'\N0;,GG[#KwYj 5^1%</O+ù>p N&Ͻ2,3B}p|Xs>Ug؃ @q|\Ɍ+!h^*ٙ6y;ʩU/Ўgz?W;m$y95j,OProlCRRg*-Ђσ'mІtF +ljjb<>So}?S?S)nb_bLKlBʋ}*cTVg cw>/Gvb>0 r.R5azHU-_o^6.'#H3uGig5w h垔ʕ=E厉ʴ6BΤQ KykrYOpzSp;~.E'XlNK%k?3)#6tqn\4=f83,{зCƵFWq1r-x>\}֝>Ϥɮte"x[;n7ZI+VYvruEK*Oڨڔu*Sw[ juunnݡ~F:3 j}U-u[x}%_cgr-pMMA "J..QKVg@b膜D3Ww\qmq[) 2[2[rqɍE\f`v`npnp~ڹUiK>'HLL]UFUb?Zƹ@}~l?rOɻ᪼_= BL1值ҟ#o4״'Kܒ\hoqY^IKʐqIK$)%.myiVc^]S9m.gg\%nW\0\d\R'*J^ Qԥh>^&XUfwF|ɋPyR𭒗o|dL~|[Tځ^t3 2?M}+Eeg*t~P*侊r,趱Њy_i'O@AG$DA#ުfo/b? @;*0b> :ɜ:ٜ :͜ME̿T1h:+y9:Ү~dr:3U4BrגT8^hC#**HU`,u}+nRRR}?5G@2>5DS(U\U|yߥJ&RH!ԇ2ʀR9U`]`]jQ禬VV+HZ[AXm@Z3>[A;ZAm}ZZ[ewwz(DȺn#e uКc=\k [z֫XR: KUFv6`w;^c_z}hz@ooib/F [*+}Mӣ@LOQF0V-U~7F"g21^}yttt^; 7:A79@7;AeJ:o:o*T]._ο]S%RTΠenh[nvu\bmmowoD˜] %%PqwBs!7#lr7WȷTw7{wUa[RAY_NbO^.52f\ ՅRS K\J.E/V1a5AxY$ڪvU6ӎBr w${$?m)'tL!-'E˩3Jr|vҵЕ2B#-tKo>6S܁4_iމ0́2A=s0{/Oc~:ӘR KYHSCAAW`~8QEQEQE9΁nнսUqݡPXcK[O:>?m7soVѕU6z, ʾomS/ֽ{Ƥ:3KO-?.D pJ{e9=~|}'륰'JxH}O^KVUU ^yvf~ 1^vg8QH0WÜ*lҬ.S]@Eq~Nbg1%MY e2̬r/!ӕg&"s9N}S'? '`N4'Bl||X@'?i> ~9̟jNȨ +)`9t_BD~E>*}TDڧ"0">Ez&@ԣ' K=SR?zɰRA.O4u(uÐ;ua2*@5KCO>`,|VU"w㴏h>*}TDQ"GEVD1$-"k5 ){vJe}h}q:>ceg-)[)XJlUm(Q6._he_d#|؎@8mOI); %KVʰ//n rX[Ao2++eW_e_ohwD!,h6RZev\K-h.vȯ]!vwo{@RaWdy/fذvo}/!ˠدWAooߍ65?ۛAozzzz     X@0F0F0F0/L0A0F0F0F0F믈_"azzeW.sc}WL .3znqwa} k.2{uBns}RGJ!8D_'.og49 @ CfC 5.,_gY| O]7cJ>>%Trf\x,IH/ON]2u&ݛv._rX]ns;,]ܻ=˴)gZ~kEve=5YTW"UjׇhO؆iڇhsi݇hOђޗD{cd f ϵ={8jO(T_$7.[_MOL?uusw>p>tdt B-v#n̍ t]====ϭs?|3,#a̧d:mjUH^E_̔fewdJCssfgZ䆟(~vGCfefgdYJrÑ:bw>6F~k ٗ!egg˲QExJ_vaϵ7-c1t%s& Y?y~kF&Uu7fXO[Hޟ~/} ~`H:Φs"̍gYNCr9s炞<zOkɯ6JB ƠMMwxAJ3O[OQJCr|؝%Hi2hz cœλIBO0>P0>T:׿&dT:Y4 1Tcn*؋$_LKFIM8F2!9=WdLFe=oJ˫ܟ3?PS`]+z_t,̞rfRfleǞ4:EQ'{CRR䑪ߧW~ηŊ~;fF=1o\ܜx>sɹpCUj,:~"K>#y FKUdtg/SoF-$#M9fgV9޹͹?PWhVէ:<-o&@SÅG[tUoenr+kT-"|V%.TZⷉ*=(~ $'`bIb %&IJ2UXTj!reZXX$^AUU(Uqbub '^MXk\/Rm }{1us97o@p[u[|Ks>e^Jr|\)Y0K/ekX;/ke 5սԽV C1@<%uyѝV]5=TTw\tQJW3Ѝn'eɏ _QK~C_^ARmYN' w+1*~L;8HZ)~~I8?m<quy>dUKrYN"~}.',-tz!k|] :H$wVҥJo fBs8c14kH}h P 42Щw0!j3J%ߨW#nb/fcw}|:񇏆燋Tsp'* 2f;GXc!i[~Up|;6AX]} OU% w {o   F~tx܉\B`Vx)knVx= ~'| QGBݑp$Dj{.Pawm&[EҿUCxG4RJ~ C E~LdFգt@ a7-lDDomJ֑ vю.@;ЇG iACXw'D'GC{1Xy{.~P4= E;|]A4kf@KM=;A?V+C-@_,6'6HeѼLMh17<X kMy+ݱw؎xHw@= oyyUmP wWwA`80*>l`_,V] `s6`'6=@H%tܗu&AhQ'Z퀎{)Hl0 $'^½Hs|뀍`{b){bO؟8̀Y$o<ۗޗ l6f{Pm̮p+ü {aH@F#8`"'ipgsBsXCw V`mc0wC@0q}JllB4<ي|d@9d%d7AܚH&/9`x7䣒cN 㓓Sl`|r^r_Er`ʳw-X<6'%woɃ#)=UDS:pKRuRFZɷK6Lu:R]R.?6L1XP`D!cͮ@g`ljB;ɾ;dž> I=~~b`0?Ժ`cW5=~RY+`Yqm}V V3%h`L (=x epO?iLY\[ Jk &k+ `p:lc+kdwWtu]/Ra7TDĕ5AX&he:إpw+ ۣ1x{)R{4Rj϶_`/"۫p7؛mNogցB{s: :F@S Z퀎>tzGc}^0 L`>"":.1%=`?}Eu@Oowl;g;ufWzi۪v<]`ͣV4\݆~sAR67vZ=lhSWmbgƪt\~u *Nhk[@g0 Bs&0}'O,uI}![,uVk&g`7pwatvx[-la^6t#Qmm6Ƨ :]ty7_Δ!_Ʒ_[z[F9|>}C)4BiZ#=e )($5h.{!21'[|d }IøMN=:Ï%)H'~}{r?JOFiI>BZ0&}c $JZdQnл(1Hր5۞)4% f&D}uJ ?äS[3)5%]H{Qғ 5R lq?|ϡd,%g^ZL])' Rn6[l|-w؆7ea b:)܂?0Ək(!aW1>:PZOaXǂo>~a*}_<"YҧI$mX/0 yϠ_1-p "=m2^H39?.M Ϟ (\ kcH?$}鯥ow\FZt}gm&=_㨛,DZv(鹔7"mGCj)GŔs|#_% jЍeH"M^)nƸ,7LPRb_/Cl^h ٗvnIHedv <)Tz kYBv,%(IF(:B GoH0)GKjX/$]MZt KT1)I-ڃ+l |i'H~$_ `gw!%Q=|u>aԳQ2!ߔa30Y0Ne:r(aA?{32~&.4'覠B}# AҖeI=ɑBcY\z9!0Ԧd-}KؿK WBbxChh-(IZVO'X, ,a!|I0%TƳ /_x3P 6{v4Wn -8\ ߣelz*4zDZfF@nfwfpWHHmSZo{%u{7H-ac>xcwэ梬{)@~#} WXAaBge[epL2JAS{dC2ȼ3~)",t^/sHY= G$g<h*TB;ԻAswCw¤Py9˹i(|R0:r&u齤I{%\AS-?&6Zҧf.^IXՙr8gtWB/5cc` Sv׌8/<Y$G{2C &~w r.?`{ʊ3!Y0WQ/ Eُ˜/_aGPcgYhfUʺKOߚ>.sz:=n{{;Dunq?˯>z|XhA'eɏ ?$fqT穔dNTFLʻN?l`vh|ߎ jP;VWߊ[^.^Yx}`w;Ňêp(@(U8\;\;\/0hnn.@p `0S ̮,~yxܵ 6` }HxCD (EJ"uF@H q⣻WOd+2 YϻoZ{]2ccsׂwecK.=\Q kG.5bZcc;c@M#cO;\@UȯƎk@~/ qq/<¸@\_Ll/q3A] YF@Z_2)t[BHyy<_/÷:3NV661.rX94mov5Yp0yP>q}m[ۉ/11/% llJCm@s%88z}  /8?Ÿ^ $L B\S`Apc(%X n n 6;9<ǃ'gHp4§8Dc%Y*~00$x-1mTvƇ,ŻW0$Cy{Z[.ZA["bMdW:.RW蟓g1:CO,=AY;]dk($k(Γ$'͋wb5Y_#VϮq_^dYJ:ڟ_^G3g."i*Kg}a0k綰ɵ=:[DJ6mrGBZrsҒWWNqɢYt&蛼Gu#lݔ)O ?5B${!M!Mgs湥XWXDomflb~&[\7MV8S<6n>%ҩwqc1W|Bm?r=NnΎ7fiJ٢\6)qqKc_agG4wΎťl-.ul3.rsg{0ےKgXK*\Vi{00kN\:,`)gFlӶs>}b'm箦"b5Logi(#쳝+ENrֻ7q>9ɸ)N˩X:H?sV0N;{iɣigNc4@Qj1~SἛK& 8OXxy9[1YƏooc67Խkjk Ob t`N- pMxVgŭ\Ϫ4V@6{[zOX[]u;*jDߢ̾>kK qn~:wӺxNB''o4[_7Nt>UTMRnӶXzn氭Z~zQcdߦ" Jx=c&;!5h!݌!d4=l|֡/9 (az|H*`)ʼllJuF-EunUEuYYT7~p"T7įVPsT7|Sݬ ͪYAUEu3 C|sjhozgTv Fjϰ?ʜ߱tBbP"Yv1~, sv~q>cX,ߠk9qnVˍ , s"/з7 OyБdOؚJgwOEdu&kpɹsng^Kxt f[eI}n(Mq6]y+q^xr.?65q~>_QFo k:Y( Y#wr=J9*%jzPe<^RUIST:ԀTUuCCzN+*ꍺX뭺N7=MwúW}IIefI6JɔJԛFb!cN漹`FuKY|kJ2l+`mʬje5[VmNZg!kĺfMض$;N35:bW5{oS9{ؾl;™g9"ԩr;;&gsr:}΀sA(w8l'B@"'IH1/#NY4y t : I. CNqvo9wBvy !Ӝ*}N┡j{]:@Y=ʷ X*{[(^m`L*YAR*0 *mZԋ=N.HyQ-ݴ$rjB}v:ZW~^餽"u @Bb<̩t:ہjZ'6w{7.}ppN3DFg :I@-N=nOs;,mw|!wv8ksdNܫ| \d`i#fw{ZjwR<׵nWGjn8Kw˭pm\>gK>my9zE+9`L;0Jvp{;:DOS?w8@iݻZyw?~vizDI;)|: _s'mNk,m܅N )[\'d`g:1i)nNG*nzl;܁t=Ul#-.fn țiҜq8@\lr4o9X#:xܱO+@4zO7,Wq loV]sHwFjO Y ͬ@H{ɾi+시s}r3~{7^oV%a(EVv>dvkE ggcY؃Ruv 3^b3N1Wg,#2oS-bB*%JZ^`mMI:+.NftǤN s*Qb ?@U=^n^@:/ nEb?WccZ iY؍E (g{F>_Mn;~H{,-=&^8G)~ϬJE/Թioc?v.ETגvJof>!fI!>e=O?'iGʭgR/b~>t4_{Eg8;| >Z»"Ly&άV:(]̏ǧN棍eL?O|+tJ1'8ԫJU:-io's>9cDfw3F҉tndLw敥n}>ٿL{#F%Ro|G~E{!$zMi79:m.8٬ovy#\'?csjPt.'tLb}N1t|N/;|^\Wh~Igh+v_D5kHl<[ig|jb%ƓfԐqjr׵s==u.9ԟ)S&קJTlYDZa9F}N"kg4޾u'9iv~m^s k<Ju>?¿Y_uidO/8>khK'ƹgzL sF ja\m5Q`NNpFVP]TE˥j.N';眿DEn{:t<c4&PO7c̿84D2lJ!x+;QD#N落|&FRsf~5sn:q4fL3v.89Fy72&'D|Ԑ/Xl~K]T0iM}g&#h4MDxj -lIH&>LR`p~ȽDcshɿZ-'nЈ _T/ Q'hĉ"q2ϙo>@wJہ89]oI~c7G+YP.B"qq_ ڌ_E;[-8zo W S&~, TA4A'P'e/w?  G_8/v#$se_/o>/#A\rXQ9&o(BhߣGy AI}#r+^5)WqMq"/Z8~Ǫ"Kk8mhsoQ펳I+/14,{CHsG .7sqD1-|_bi[؜cl3ORJ9Y k,jERWA^"k?'CBP  Ň ;_=yWⷯ.sgq"~C'7lPRPr^ftza%~?ѿ O7?iPL(.4?} h(/P~㡵CB Bz GySZ~ә/hһ`ETφv]O"9zF,/WW]B/|eXJSEo;TaۙxFxuABh1nO V6k٭ǚns`*PkAn<vP@G<| t.xK̿1řpQ:A1J ~ :~tztY:G^<7b]@u fP@<|ԭ{<) 9uYq9Ge]`=WscØ7tE,3N@I L|^kث(gI#c?o}05_; :#I:G|k4 G~X?|M_|x^?'jfQO& !WzNaEGHcEɷ脕}oPo~~pҿ8JQQwQƨ4~럠6ZΏE*ʢV)6Fm6~࣍Qƨo}Z9\N"WnET"n)?e}m*v-'gx/ih>e_*4w{O3:6t^vlwzQ(6Q~7?Eϡ %ɾ>rruvqDVH|Ш xF:x'@9!̊oѯkIWo##h\m춽Of:Z2Qc.`)yYQKT*R>uT :W赺\7Nݯ/(lV e6Mؔ0fcӔBrՁ43n1yy o3X]u08'BLR-Qwsa4f5d}έ>v\ FhqbtI4Ϭ5agRPtF Sv&cԅ,M֙w!M&K'E\ )rwYv]EKSn6h ;kRjē ;].bTNBT01#5&tCaUl>v]&|;< WU*=\AzB|W*Udit YxJKgON+a\Cڪ[u.˨ ,yHzi9Ffsoj N3y:Lq{Opn_ྡྷ0R̄IBrпf'bR(:fr4'8X{ #K~Y3{\5K'HjϵV*5g8n;Ks\OZ* 8Qn~N~pTǵ,ь3"%aI}""kyy%܇!7+UAۄvr3+tvfa!=]hhG9qMFc[%c%e jRV:^ԩ:[o[1'=iBxs1]ZaY[Z:l X;g YKpWqA2lXi1 h]=w-!zRa` {Ss}TLR넕ʅday1sV"([x)$ۭad.BRa.~YQad 묒02 )6b]# Ii25#:H2VSdlЃ\|s+kh1!Ac%efEr$c[f>\~҄d:H.v=law$f3ú|]);=w)ntYFagMcHZf1$:+L4ƻ>Tס#CK#X(u}ڙe失UpH $Y b y\71;v#.FH. ] U;A^nYw}vH3!Mw KAA2Pc2n' yA^IL+g$㹬Q4le#8ٰCoEP ;VCrGϡ"or@p<Ft5}CA~ώ`4ZT_ºdQGq$TJNRUVj.+?[@u@+HJoW &~/zNr=K\mNHm>ά7B Pk)X^VFFЃBh1ΌggZ4b'ń/Y$k<$E%T"v[V u}0tFCzq>ϳf-z//#}ѧvzoƣzs{A2r#4T#}Lrni΂* ~}ӉN0:YkM͌XSxӠ}5Qt/h96}@aM;!r btD7(~LN?h${ލ!nQ ޶XSz C:ɨIgbǮvCNFO{q9 ~:"^jfTYR+儜[h:/XaIJUĚJ?3eٲOmgVtSvU,٩jXSt٨3@)QFj=RY4Y Zw d^ B( wd5,;%tRVlJl"Ws$TjR#|m/{ Eq]=wr<D<0>E 1hD4h"QJ|O|%E%hzvgn9DGuwuuuOO\N9I\׀MCNĥ9^H\XZuNV'.e 46$:#/"[e}"zG>&t2,(fY?8_ ڿXCESurádf"]bc'Z^5GڑGy"Dɹ[,;6e뜇ebGfPvf~s+3&'{5X٫a<)$;2s}NABS+k9_?JZ)]:>Kt=ImYCta \o{hMp6^ t 2=Iiէu/_ h4%\C1ޝCU̩Lm !:w{wOFB^ Ɓɕڶ ]T*uGe[HڰU \jܤ{ZVGE{k?Vg]Swy'h9}bmp%ozp?IC#ZXQߥ˹H m'Pz5\>'<0<$|^xhx"*bFr"yZڑHAn^~8k SSgY{y ]ȵcI<9(%[9,gs3}).q׵wڻvIcǃO );UmwR7}0η8??*8;#9YȔoC{cx en9%_iwoe.Yе(>} kuvnrOqݟFL/SKbڂA լLiݾ){OPSh"{[0662xD/d {nʷWs`R)J17jn;}$r_Uȸ6Gf3+Y<v?sߺ1Oy9^W()ԽZרe={U.K/=A NN NN ^Ri9!rbw8'rZHy#C#D.LLLLLV9T`Cx6o<95OŬ9F#r6 5wSyPC12)T*dMqkʟ6ED;NI 8x=12 :%iJ4.aTSH73 UE*xc*x<֣eݾ ݐ"S%[IY oY>;(;Ӽ)KoD[pӵ%KA窺V^Wwʒ&7aO94.rҮ8fJOӌKrYz+d) eljJQVEzon_PJ:gJQӪ`R/U־vbx[Tq ^sZb [˭Cz3m3ܠ\mD&nS6w-ﶧanG]vq%nwD%i{ۛƺ}h{;&bo*/ͧk -E_{ 8&[7; .yy#QRo7MxӼ o7e+JY?a-n#9L8Oښ yv{+֩/*s 1?|UGC*_~h]+Rj[)vo=cmES x18p$8p48Rp8pp$pp57߲|/{PL=~/}-N{eJpA۾zAA2TS ZnUZU2n%ߏ'3V aLCz(0lUO4'.?ha˰l0NUݢ-FpRc|͘fW9XBR/7⧫;clƯ360.732|sۤq 8ELicc+./oU%B=b|ͩ 3:1fC#O Jia/ZS ۸e<؂#^su-xS:BA @91K[&KgN{2^$q_였c7[ly0\$0 h! 5=b`Rڍu]z>p7Zj}8Z]&|ܔRG8JGƛT'%<1 /6obhHZ v>6LRBpx@B"ƾ%\l/3Nr`|[IJQ|dlOg5{pų"ߠ$ y Wʩ5󚨏w6yڇӔdi>ڏTF2Y{r/e4Y{q2UYrh4B[ocJYh˔,eJZ S,$jS5@LR)V9+/O7T+%5PJeUU+b*S)ՉvPf2ʔTU_{u*.VΎ6FDEG[D[F[EDE;D;FDFG{DO-==zfh~sCF/N֜kC ,9&dr 66Ԃr%<. vvq:F;R- fJ:LITLa1c*OL\SKۗgGϦLw?@A9@ "3c^B\?":\Lɘ~:>:"\It :25: 51}}&BSNtXtE\$+8/bZ~V?m]l]Lr6ʩ#a eƐa&P5ɚLTk:XYQ}rJ[?  [Zȳ|kZRkuck=Gh[~gw̌Ʋ;wƴW*{`UKxx ^d? e/skweVVfj4ŗ9}Ts9ߜ9t % 4 KOe:7mSe5w~fGgi0\}l ^:u;F&Z3]CW  m2eb!rNmc2po#~Tjg/-1>|)Z`bQcw@l`<U7n@ B{_»Gp`W\Af3QH5 p`ār51o|Ou9keSFKAOOE x7A-`< q@d s+V8߻ aN2 X8:{@ xP"@pz\/GkO `qfJa͟m>P7<QFXEƎRgGD +gjzQQTҾ@roI8M}Cڤ+g8ݩv ]^r)O%dD}cn\|16@s\h|Ě&z.JK0JJ%<|XqS XS X1T XT XT XQU XU XV XqV XV X1W XW XW (-1WV XV XRIgaN,,3h-, ]Acc eyY]ޤnβv5,5?6I(qmQo?ϯǗaE[sXu\l;e r>K΄Rjem[֩0"kaɊ\ wXڢF!+E^$fAօ?Wьxњ#u>{1boW;w.r?3h.Vk#+^z Wz'Ik3_FA絸"cek>z}+Cz'^CF >X o;X&V(;7^9eq0M8}b:)c:y%{3,dܳ{܅Sܳ#sS\ǣhIz И |Nd2{YcJsw|yhDـ1ǔ 9W=51D{q&8FFlT6a˙2~$4 zr.16}a9~kgnM$hu>ە)t[9'i @0"w'@ȏCF_8&0x|p^9GjN2gp@3sZV ubuYݭwn5<\y߀}&ah-PK8\ [/Z ?4KcRa׈<S()ίw:2Cf o ڳ;l`HM@"nlf~[]ﮧu_t_$}?nenBwLmmw,w1;ݝ主]y~  R o7F p y#Tg7do2ǜM瘗yq˽˩vRd.ߚ۟>Xm0spW|quY)3vB٪U5uefx w,{X11sCR3v{lEv6ĭ|cy|d<%ÞdO10ÞI<Ōf1L"{tN[1bR29̅9'qxxqSarg`59_)S˱bgMN2dT6}co,33__P%rooK-)s(Ǎ1G$sXL/:^zu)Y=T y!GY B45S}ׂגBLp^Vކ胟w"|@͔^S#"u5B˹Nw,e+6Uo&@sPE @u)ksĜ([QtRSML_'4gBU]ܮS*aRXaqxoŗ`xn[0_oe|6gi _yQn =ZQxLj'?Q3Wwkr9+^s_}\XσI; 5OR RJeD#*~aS1w +5NG~Mbwq . XbGTTX\T']R|k `;uF j$a {_atXT3ܢÀ[vb/X"Џ)-j?rOy 0 j>g*]7r fXp'$L%se.ge[>"Q}~4i8q3{~-`x+-t/==|5Ɯ>yʵ>`+W(=eZ?.xb ፈs#⼂8pVĔ/FľB|عE)^=-6Pdv(ÙIETyMJeT=BacVS{Sg۲j.o[]M βUXofyH5υ͇Խz<yw{ۜ|1ZFdy燯gO/7?KR#cKk$OM]g:F]c(վNQܜF4.?.y] X9蜢6)»-īԟFe4&wOdpqG/x]/m_EϮ.X4\4aFs?{; IjU5 drƹȏZ.l)cgN*'ȼ`1'O2}BCg5ceS/ٴӦθdxNѬ<7n'i;h%5Ƒ;u+Ҿ ]O(vMYt#|y^'hҿwZ_?mܘMigP;ҶcQNm;oߡ}ˢt 3VhИW5hj*y>1>ߘ׻ێϧ>_{ZxUqsWM_ܙCq|6 c+؆g˾dkbY]B%\ٓ I Il%x~[yq_83|Y Yw)P'-rmP%"8>UQv X׼pٸ4tڅ5"e½~8Vz[ZLBkeXE,PqC%Ĺw,ٯWxaaχ?8iFqx/r-I?oо wkGO?ZtK\tVfqΙ+^^gPI{Y`p04Pr3"vMn{4(iTlK[ H hΩ|R#V"S߀BNVF )=>Oh;9WO8%cɳ=([+Jj0.)(Pp`Qo W 8 }NxU"!5?^%̲ܪ-~Gi`:rs,a#tdWf֖dEXTTR L)yV;,e 3_knL,!D0U4bpx `bӻs N*+#8Fǟ\ˢ.qY$ߴKN>_pӮojzsʴ^Ƀy{hj?+sBls"[pIK8z#)zgݙ{vuВ"%NŮMmmSuс;B-Q;˝yM]Z6H Ir)SŜ-BĶ~7F|}jFLfXI)4υ3%("6ޮ9ӖIU&1!ZAgeCf |̼̖i:,ǫէ>)xD|ϫ 3 e1wPMmUb;ȼxr2Is7ڽ!$mT2 _\";6r? x}BfI:?e"&d%bUd\"POJ7"5޲7{cgnHYRVœugM(†++YnV1?:?Af&vc#UuIԭVOQV[<[͵zjxkoة6 V#1\[u$_S<=+}wz|Dy5) hT 3Zv7msqkSZŝ{1{IC žqS'7MAxuwq;yUn޾ 29@`eyXvR '%=DK3=co۲ʺ^s2}xVLPUK)< xq6iۉ]\v8===ipY=a])MJ5ĕO\t~iZ=!ehnB?r<9^rgԼ8փ\34 9"$R12E,Z4ļ9Mh6u$МЬo0˫ TtXfXͩvm}hyKL?C<ꒌon&_LI'A9 ,ÒPVD{ } QZ4kk_>mfV|8 r=h}n_rh3fv<̞ǫ' yOAMq;_ t|".=^3y6bm4?yDSRߕz py'2?_Tvx 6ToݑiY ލaBJ|M9f![Uc nz 7ycRc\]N0E |fh5~C)H?~Il1WMvtެBcBHw^E]-6{ %/+=#~T0&l[ۀX"% 0mఀ7ӐNbr߱a0w@ctaݗ ]6Y_-+<SG~MD=BZA܃,J|5>aN!aܾLòOTs : Ō}ΧdZk,_xl#'ǖX3f 2pF{yqo|ӔNCg4ƛ[|N 4if?|0&Ultk;=?;#R^c]dĀ奣M<[ēT G#ŶKVyđiJR/*cv_6XNl??&w΁9 iܗ+ AC 1A!0;_ &Y+t#3Xi7s#F_>`܂Q M enܱ6g;lN;ϋR ? RrƟ?oڍ H`y!zg+rb>Tv!A`=_wys]*|cĉ~>HpϡKgŧd'7;ۡŕZ|yoS~O~IK|LasDrH }ʙN]jq&ݕ_=*QEr)-Hrz|H10X` r=ܱ)xXV>Q=-X =)yjYhmX\=:˻ТBAy**DTFݯ_M:Q?"|1/5bim [hIaF[[KJ(Pj^=܋7QðlƧ郐F륌B]mPT7D*PY#Gaϕ+yi/Z+ךy7J"cw^0;K"0 ڞr?"Q3# y2.N;XfC|w/ 4rйn5͂|]}|܂x"ba.ʥYYډQDO+L3:Ȱ'KEM8mX!_lZYG.E"Vo&zH|=x2 Ö!<7 F y1rb>.-̞v!K7ZIkM 4˥/eW]şʬefa8Wj>p帲dAw{翐>-YJK}Lh; +āV*܅5dIu4O2Dm|, „9al`˶4/vh)IP%c)@+>|p ׶ bBM=:z[&V/V5-?\004fA'`7Zh+72L](Sc:fmn͚%*nCŎgqz#t0)Yˆ"Ng }e~&Υt>stream h,O 0ƿ{xn)uCEaR[GĀKϛ$1CjJsw-Ĝ0SFjsEaU;L G취CX9xze|)k ~9=Ey&j`S H30qfp?X*W{FW endstream endobj 5 0 obj <>/MediaBox[0 0 595.2 842.4]/Parent 958 0 R/Resources<>/Font<>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI]>>/Rotate 0/StructParents 14/Tabs/S/Type/Page>> endobj 6 0 obj <>stream x=rG?Q܊FӗeS8o=M%RYZFi`‘ErBS3 qkѫzWG|ѻ/GnGo75\rqx|<;t/ʢڶfBZ- =|ݼ|q勣bXٷ"-D%ۮƢ*B6P??9f kB Dt7?Ύ2zd^>Uj4b/Bʹ(xljiHU XiQN"ekv&゙G?,n.g˛oOO.JZUB(ͫ[ߝ| D0m J;z;)p4KSWe)OekUXJ9>T| P x/_Y~a<)TѶєx37p]9p[եJ/绹n",Z١gkj0{Xǹ̓7,CG_؟W?lU<.TVW7u(-E%p^_<pE×':@Uo;^K}ܿN{|c7aa{#w'XX o(j0ҰnTs~{|YA?wlodvW('_i6:0~6Y2HsэR/Zj ʑuEm q^z,Bυ~k?5 pY1)*XU2dgsS˻yYC*>d/WaYEYک-OUJk.Y?;)$ceh˧ӁMgZ >CUrӎ`vc`J9ѪʻhEQVa} L2 фa<@]tvsz1FĂlrGd޾W+/VM;^(}MR]2J lKPvf&X&V dߏg}(#d3ϟ_]Y$B.O^EApVt/ 4O41.w"W ~ LDaCH}!/tKf9p"JmaAk8vj`Jv1$0  0봡mEʋT*8s`t mw!Nkj݋ 3wuoQU*=ΰB~6ye!3VBKc Ix5#6'Xψ%FcJparoBQBWdfP8筿CcR)b"w6 q b}- k@+YmaCrGqsn6Bu-cnldhG} PQyv'@u\ kx]gz-mx96ۆdÝ%r#4zεȴJ$$Kk8Sk-l Tth{+E]Nm״N {pwdQ7PEN)![q93` ijɞ$`YAC(67o-^qKgr%ѵn3y̴p^z !ń4JL#4fâɑ%64b_379TKj](`p]RE!a0ZdžXkyug ,Zhr-`n_I0Q*jSɵ")]4>j:YM"}%v9{&B=ƚkJ"܍ 5Ɩk)M&k)ѭȳ Pcܸ֎ed"1kqEwk#K+%\V a9nDeH:t7ѝŒ, 4`![G{/$PU[zE2Kxz:Tr?DULε*e;Ki:%Vuy۷ ք#MsNuJ/ypDW4Y4p!m*¼Gu p{&,26l"ې$\T}h!;4q9.N߃ Nh +GP0CM6@ h`{b]8V>nuz^Zjv潄}fNqDC:U^zzQ3e]TU!x%xdE^zFx>= Zx0"X:_oGc*eG毽mK we#7͆Mdc~`']e혞t ry|{CJXC*!(u{mn'x VQI#sB NH61?H= ,zI\@jXYpD% NByyoͯ 4wQWt ~0Fq܍׳3A3갛w3Uc?0_\"Dqd}ΞCl^3MT`帛VSd ܇7?99m5&qgs,"zE?.{ϫRbadѽ0 Tp\xb.s%P+0f SM{jұr0Λ]nA9`71+K,Ik3pwS6]+Eܩ7(e1Dܤen,*: FXUͮ^X#²#ju6Pf·caЭۿRIq_lMXX`?F\6S\m D>*#Q"Zk5wIPI%wSw9jb=Em KoJrǩH}}@; *eQnכѥʠ삜]cn7XV̟l5P&I'T.N^Zb=(g8d*y%E /@ڂ.O*gӿsܯD 0DݦASG8U%9p8xQlǧI& O9u?g$g&CO0+ut0cpjǧAC-;?28zR5ǍrZød9'6EMtY&:1L̐~頙yg?g/{ؚLv;&WQ~T ©6j<(jx܁%?jRG"ᆰZwzx`Ow,BL^WSV7QݟPe0v5 2 lCEVL(rI2>},LwE ˝q4Nk*mMC6`7ri=u'/7X,E]V<_|C`rIqlűnH}|q2>}Duߡ4|AUBxaHNWG4iQY;/ cF%2ң9sA@ЦVޏ,RM pRdetvPYcDLv%DmUzԉCǭIdK!nj㑯3]ؓ:fE@Jo r趭5@3mוioU}ډ(p*:rHS|rQL(,dQoDq̵ b jp2Fcom!AԘLEm0τ@V_p<U @3TeSG;z?^ Ս~fOKuVFi\Q`P^_aդAޠ՗QiP-/ն]_U;$? 5G|x{\Me!d9Հ1?wb94(-t:GNϣ*]ž̺C3Tޏ tSqaY`a@/c3EkM,Wem4ې2 =ʵ2hN4fafp4\\B\v2gTV][O$[0 "L݌ j<8tHn .77uN趐qbZ֭Nc\ޜR^MBɉ^Sg)Yy(j`xlSO]f,Nv+!zK+R;k`q+3$J -<^07~V5= *NJ#fQμU{UBo4X5KH-c\ - 6˽udOzUUGE0LdZnYI]EBsM#[!fpBcI9Ẹ.[,q .tfdR嗽ŀMÚ7 kBݔ6]i.RcI$fGQIj8!g8tq 'UA %+ŗ*ymXȌLϤxPͺNeI|2_KZqXpufآؘ+*:j ( D4FU{qIE*%K2o(* LÉ;-ttf\Uk%#HP1p`lms۷ET96", Uěh6VE6(v%Լ]F y2f²AVpC#x6eOh |mOLox,.:(hNA TC-28?!KAG}]{-8ifcXT̆dj_(j['`3gqؐCz5=\.yFdaBlAhb+b`2f9 i0fyVҨC"Ϗs΃} k̹tORijn弪7M›rϞw pq[E "탥߿+2u?>u0PڵoΊ. 5RrEf=lZxT]*3xv~ hr˿9O!+|OGXd<0zXS`y"X=|~kTE\Jd5bi^JG4~;N=~2Uvqj`غΖR.g~FK{|qY BjK5yzu3ei@徻ߣ2q5%(Ϩ\`ۅEC)Xo0$#Vf~ aLz*E;g$D']WnsH'g+^-yR+YW-k譓^"oaWV! 8]ꓝlR}N' P۶_ C$s9qbXC'#[v1䜱UlX+N(#T$}a?^|e%ܽ .D !&c0w9ŗo{ZR"ˢQki3"=r+2fE>ǐhDЯx&o鱗˫ɿ r%{Hthl`ft^ZZw Z(~'z%yNQ([3?uT_SlyFu.5!%G`$n 샦E8> ]^H My'/9wF~i: MŒ fĤ۳Jq $HCo ;R V:KA $Lj0v-*ۋ0Ro/7e!ƃMC5"$aL_~:e cʱ endstream endobj 7 0 obj <>/MediaBox[0 0 595.2 842.4]/Parent 958 0 R/Resources<>/Font<>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI]>>/Rotate 0/StructParents 18/Tabs/S/Type/Page>> endobj 8 0 obj <>stream x]o݀= kKr@iHk}HpV\ΐ;Dϛf7Go7磏_>>]]mnַGN7poNjo-x,J~Q..ĢSP_/ׯN>~uZtExU,բEh3hWJEYU|evlm}R?qXׯ՞YQStKAրC% ևB/`< >,[sG-S~ÿeS<³O }eט{z|ۋ7˾9XD,;xuSwD}XeSn?E|]Sa̼-rlֿz2֢_u\hcS{,EyمVr-~.ʣnߟ,d)Zjd7ev,ZW =~Z ػ KE^,v.WgT{ܿ^=d~?!rO/{g`sO,棁wRjZpR uu]b| '-҉dz/2mE!9; L-s Q[[VЋz YYj OZG|7=ao<-1N ڷ< vH]24li?<qf_2O;/ @2C7Li/ 8@7h-p~7$sN2;>c y8yG|yp -i^K|j57 75BTNbzd:vQBuˬ3:\LqƩ5_/8ZYkBv-ȸbJ&=WV0( {?=*|a{60 m.0 C eZ-3K+ %#E腎aS}WnY'Wf@Q}eEn]sq˄4XwWAXh e s'0mDV]293VώV +YWrc@/KYt),/Rxa*lS!<_J+hUHkQHѦ5Ɛm@*ouMnjě,Ԡl+oє4b[ =Hhn+_ur\uog-屦Ady .to|s|wjlo'Nwc/+VwW5ᤀ2fW$`JPGGhjghAs!J _>U<^ؿQT~1Q%0A M+j'tu):<웂Y+g`Իk_rdʢgq.ڶZ2e2&%AzU23W z T5A+ E % D<42vĎݓ`Y.zF`^ݩLVsi>QT2[L+ cK"}Z͓Yy*Fό`k.o*//)oi(QuA(#2g$FD^]ـ${T $- f|GơpZ':h8r˻D  K QEqQ# Q%Ynf*8R^)w1`@ytszETݝ ͡EL7{<h S?>qmiMdKs2/MٛSg6${H IM9,MMm#NT}=X;ǐyuGϳ8B(h*;׮Ufͺ۪jaSIE%ۺ$°I&7ȓD^ow߹eWHTw~2|;nLu!/7( `J܋=8E}82{{,ۑdcg=B#h6}I8`{e3}aCF!Ą&*qOdWZM p3(TݵF.̮,kdNh )&5OΧ%(GvkG‹[2gS`IG1Igً}C3&F3 * #)d$]%̨> @3ks]~z\U6b븚KR4Q̾Oaڣ飝.^.e }v,2Gʢܒtԕdq]z2%jfH/H^9s.sWo%ir|jc/Z=)m7 [EQ$73Z{m^ k?updo:Lf- /b [3t&2T{7"(BIt"AHpH%{QRs1띹A=?5l5$(2WmML5 P'50­IL]ղ`d[(UŽuOq ^xð^i{{,cȞ6U}yܿ=1d۹e(I]Oi~JhG+IuA%m94YyQgPM!O4H Q 52롴4lj9R*,s$)z;1X-N_K~񱨓TO1a1X5jdPe(($6;LQ_J&p Jp(N3`ΐ A?t72)$ހYapB5׿E~&81"ƿ]k :#@rH|Bhf-H%e= %ds}2pYV iӰ=%^gڰ: ۦ`,f( {ͼM07,8XQ;S6ZȣQvakB&4M Q(ʑB|Um ~.A%)H4FzWnN3cM6Lo95KpJ*Mpϣ9\uʨ.8ʿhliJ !ؗ"`2K&ƋFjᘬgkȶvI.P%$&]3ȝI=:0g8yfkeD tKNC5Yi;e\vUrҠ1 KDOMpj_Pq59KJU}OOb9u3HfQjB^aiw!4އ0uLbJ۸2w+m0Z?U ] *i#%2>*H8eq(Qc\)>QR-|IV9qػsm_ycgW&i4[4Jr!&)>յE1n~IffiI` %j[!M,lb)XAr!2כ)h rlfo?5P~Vd1%o>wXI-(Ch^ؐ4#+-:\#o[hDHlGIeѲ;xNT6!hw9 ctq6xԡɳQ{uȐDBpm'ֳ W~cSg ;9ʯ%0fRݒtFocS䇡=gR"}Pز35Y,$DtW\<ڎ1Nh sK3|JlHs) C3Q3Ԕh '(H1g0-n[jr'LH]üFkAE a0^Dҁ%3ɒyqA9M6(HfeϨPܘcEXL䘘1(-@͟DAXy\5 =Y'#ۈGm[2Ue0e?FE6[a%d&k]ϛPo7磓fףwG?nnWч \z^o.>AZx3\,>jd6::Ľ131Wm'G2(!E ˿m+ ^Y*֟0]{\i[دrwiŲn;榹`=$#+sEuZtORGGuCa^ȻȐP6{qFIf1̣+23CM73CF#@m%l8oFhkݯtnso>d9buN^Jw-y]+E̅ ~B"R endstream endobj 9 0 obj <>/MediaBox[0 0 595.2 842.4]/Parent 958 0 R/Resources<>/Font<>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI]>>/Rotate 0/StructParents 19/Tabs/S/Type/Page>> endobj 10 0 obj <>stream x\[oF~7G(΅ݢܚ">}-H-s!眹r4nÙ33^V7]r}]n.هj=߭6N6{9_,!{UYYO]VfUW4k9-xv?;NK+Ln)i`PEݢ32S'9!]>ed.oWy5Y'gI&W^މ]^G.MVRɵ|KWUՓM/_ meGVEtmkn*.]ߝ2SK _[l`iDeo޿frm]ˏ\hOڂe1{PV<`G:JW6 ^g|}Mۗ"iJwRnnAvҍlV~6k>%U]5Юhj. {%o{.or~=.szB spZ߲w{N;b}e$o/+vwx2 ShUsr%RWN׼ZET㰦=ʢ1]H̼&;%'k ]ژ6%9X6F9b^E`*'=J~Hѹuwa jkOD &j 3ZEw}";ϦB4(i]-y0ӴsuB+csb`磜9zC%:'0ZpoL*J&˼aN޾Wv_wC0x?D*c=RFQne`걊2+VP"c<oLL^‚-Cw]\V{ٮK !oei0|ꋡ溆a 3C8j zúYz%q宓*wɋWJUF@ |ep+ `mӍs eG T(On 2G!diYKj̓48A&`5&C>'Ĭ N:FP4̌JM$)p&)J?t|Op6?sVՓ_s0,W/pdYy/myR8#E,d+wdz"?}:ޜ7.ߴ '\\M`Ⱦ!Y=f]نvXo  s5h3^Cv%)/RwSbFa%0xp,M(P]FΪ ;G0368Rw2 $92=,2׬(| AzDhCF 5*gy0^{Y8%#qnV] ꁘdTuPv`fg^eEEBiwR\¼R8"вC*_kֺhjz݀ HIdYO2&.VLiTJ/Tώ]vQz1 U/J$3Cbm_W,z[@ ~?@rxψ; r|E?JQ+kM[3,0q 95Qt8e҇$E2A٠#7+ necٛi \U0d!9,0P 5s|SQovҰ+16ᇭ3^PA%@vT83UDr6nVR\c54Q+EUVxUcJ$i[:1cېd0BSSC)aL<9ؒTdw~`hGJs!kts!!$A!Pa}8%l5*D71暴D_eQ>5o؂2H@Cy<s =d+ƘPQm>=ݏUWR"[&Z o^!woۺHT9E͊X g}έ~Q0˛񙧚WMacJ$im߬ $HnA45jsp\|=ՈӿN ShuW ㍺4J+`؛jD#fdշ uL1&-W~ǁsG@(\8/GZޕ O=vM?sf#ئF P=@D$uRm+s2BN?&wO>I/QZ1{v PV!r%|HEYp+5j|'ZOHqm<Րk>e&46ʆ) մs(u >=ɞ Ԛh8dաap!!uQަ񲒵}YYSb] \t1YЗ* *R,te\3oxjA{$9^) 2wݳ}ʛ2i endstream endobj 11 0 obj <>/MediaBox[0 0 595.2 842.4]/Parent 958 0 R/Resources<>/Font<>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI]>>/Rotate 0/StructParents 22/Tabs/S/Type/Page>> endobj 12 0 obj <>stream x=n7z`beg3z!Ԓ5Y|,E6n9 V΅Nr'|0?y7-o'.p?泫w瓿|QW5'DOI7N+><?L_82|~; t&]W|$}7yJ'uEE+|QWEx?Mk;&ӿN>%~bGd{,m05PF~)!G1fvݫ+Ϛ]pN.m}~M廉U%%\|i-wEyDiS@QWxn,' @׿v)~tB$'ڊ LR| o'' rX.ҪbN>؄0#8U$yJyYpMN@=I}h~t;-Oڪ#Ykɱ|:Gi Fbcw<4}[׬>=&AũuiG7o5;=)wwZw" XD8ľb 4ۿCRy3od19-WX*d=1!EK E#:߁_;MYw$"G I'5?:h9JWNV /qÏ~`2䵅vI-0{]P/YS7' \#skRx\hWR嗩rb(YD !VЇiǎps >I7Rϻu6pҏs[S]qn=z )5KX($L=qziv<EǹrzFyʥ*D'%bfiwN9r|\M'߭i|ofxS}3?4pyjkД)\ rT!E)=C. >|0--y  enˍg 5Cl  uĪt`)HJNR^5)X͆IhŽ}¡&deYw=8(bqcNꍷRp$T [7xvî9tVd>h|.1\`BuYe2鲊*\ELQ1*U,Iqa`AseA|(2Ibd@v|V[(<؃sMQ_!BOE!BhqDX=>f͐Z>7&DzYB桲U#7$mBW%~&N1lgT)JH3}#mHIфB lU|RPyl(xrjɻ b*3&3.,ZhDQo(PmGƽS!3"u)~u5zYз.ټ a:Ox6W^o<(IN#oQMDٞ! jXnPT8/*ZPUMSk6uKl\dx3 'XfCv4x1dBaМ"Ξ#ňHZ#ppeZF&H{RuLkr\.f{'t{U >~tpsDH)Ԭ8F)o'%ZԾ;1?r\uj)DK9>cd.x>;m'S24j)9dB-np)g)8mF)8锞hTY8]S]ָOCfD)g * q`v<#[)S&p[cUs!g*}w,fJH3E>RizّByx/ E<smU'9hJ]W,E<"jhKQgr`fsRmml.(|Ӳm\vPI0#)2^Tʣr$2ERf,Oqq$w~zexnP#Țdmͯ]aS1 ˚K3bhkX S^;䔲欔I֜E.j~u<;t,1)HcZԭ,enݷlr;`W:ǔM{*ًpqJ`yC|ssޓy9m0zJ-x<3O Iznn4H:\:jJ:D"ӛWR68&ղh!< ۡhO~C}!1 q&qak [n歒=iz* ЯzڲjfBjXp^2[ʧx)o>ŵ߻,CvȱسD?Plv|݁ }=W<)xI$\.Ǔ4h9 gTthb>$TTs!i(E7>%`1σ,l/!y2i5A(KN_#vt=D VSsN6E'D43>U- 7cVUBL^U쾉Y w׫7 [oR%?zg 꾞i Ƽ@v^r c=xܣH>!UtVmyVX-xbPn|o0ezZu]:i 4Ealc7&Uk 1*ڦU _J+JSt3"7Q_%@-[(BKDwL#cwMr(Eknv! Etx؃ MӨXVxzvP{.a,rzFθNK'(Ϫ`o՘AVd blRvz""ĕVJ@uBa5)H2ȭZܷ+* 2kC _؟nC]@e4D^!: ,2hg>*Yrj(luFJ+VvɌ=<%5*q [xef|>^a ŕ3'pc%#jj8&XWI>sHszLV9*h#qxx<;^û9r]vӎkJ P4UKD7 ոU'^ZW;ܙ3Ƹ;zRڢzn7?F^ksU\,v;aifW>b]qxsM]rׁDLlr^`f0cOC^71d#Ww,Jv.pݎkayڪE #p- w%š}~M,L x46lmG=*4j@ߖgwL+6޷B1; 5EhAK@q{,u͹xby8cJ( ަWx̮SIG\;KQj?R#x i Qȕh^ҷ(D/F Xetq||Uj#uOR*Lkw\鲢DӍ<fKȾ[-诈r6&0BAM_R2QvKp䦚›I06DWBY5WgުMi@I餦)OŶ0"ad捻Z! AF/:>S'u2|c폃x vD*(Ikzѹvqi`q<"3tU6^keU+|&8sZ_\ƕ){mʖ{Cµ5K+F .m%9/TD?½C!t>Ĺ-<\Dl}? -z0oM0t(Nt 6-Δ}UFK>%+&dshmۣ4axv84}aVuʪٵj'.KﺇUJ 'h>Z=jz,k (Jnov/$&p'>9 @p{x~,h)`1aT4AF-ȭe6.!D~10Rı5 .Z ly=~핖3br Zr98|rX.z~]ܟX©7r9T9뭰O&oz] 񷠤W2Jh%C{ KHV]uOA#n3$ѢY /"#Cq0?)M>8Lߟ3tq61+8^ ~ڴݔRUH,J7sku I?p9٬aЏ[*kpQwZ"ͺ1fu98%u}:sC8*P3i9\GzMMdD~,,5l c o50j7qͭ) եw ?M9W+ubDLҲ*WǾdpdrUv*tk##-'.VG&}̚QӔ0o#Njj)o {2|٪>򠼫ΘjW+V^(Um?hإWF_9_&h"G=wcPswhH[gs{ww[M\V #~v8bLݕc E1>'MZUsr񈺇-_[kUsۻ-w4Z]WHn⪏t}I/`Thy Kqay~E&\[Dkr2Q 5pN3O}sX3w7tYvzܶZ݇A w˯6dI.0{d %-_up9_戛"` bu(#:^y1G[‚J>JYC){UAxXI ;\CDze cfk@X4i5T9,W:UCOcTs]4g֬:B1 s/\|C AInj>9)Mi~tńS jۧ 4k#%3z59JJ2'9BDBi]d psvn I\)%Tv}Ş!SEL+3>\|2,R"K 8ZIT\}1|ry2ZfkNrf7)H5q$\EqNYq:*lFi)ΩB4=t*I'CH'OHQvshmAW4qFϸ/i5 Mnɷ!צ*]ἵ~pT:i]>Nv{ ST̥ɈK6&y3nC96ġoN Q4"kͫ4}fa:]LA)֙H3iHfЭNjYe??UA|7Q*YZg DԆ'.Ź4 z<.hnqIj M Ȥ&gN̓v')̑3B MB~HoI{m`oz[(ֿ] (؎@;p-? gi >*r0TqPMSE4U:΁wguNҜҜ|B#,ӷU! BxֻH U]JR 9ָ./2v_^i͔`- Z% /olQ{mG]={0.%Q5QQ&eͿJDr%`*}h#<هKC^AC-4qϕCҫQ=$T 4n~\]@?;ZM/0IGϛusEVh #} f_\-"\9% 䩣(!]AL1y$=4PdZk C $jDF\-vWCsR endstream endobj 13 0 obj <>stream x xLId 2! ;$$aj ] $@ $1 `TpATpʖ3hr{ߟ>uԩS= lڿc_3icS/ks*x?8srL9-8[29a- a,DBKL}\9I(a'5ggNi2#'UT>| @PAJ/xX1l̄5>v\2hMQ+G)=G;6Ȯc¼ +[49mod;`y20g?.. i2`OwCݜw=232ӓ6p%y =- c9e5!N֓bŗS(KeyOIrP?Z2߉ٛs ¬)d{%q|5Ovjy[y3ZZX9`c>3F}9RC!38kƽy|b~C :YNxO_8-f}+arπ&Õ                                            yȫupNpRpHGwVE:wQ#(>"Mb诋\0`0V?нvD #8\!@lCaXW1 Fb8)kΈEb\{E\ #G O#aTȃb䗋|& `(j1 c`h1PQE8(+CBQ E 0.L Q z(.0{Q%E%l,^L(KUP6LLib*\77| #nL,"b6TU[qL.nSwN ~!ibLİߋ{`b<] 3 $q̺Z,Y?0;F3J<3!Wna##0Xs{GanXsϊHHÝU G${Yy*X 󶋧`!4o ij0x0?[<G50?OtkAE%^{`!a,/6'˰$Dl%X2T 4b D:8W!>iΒ&3C޽*'$}7 }!2~dCV^5cA0|Q|tbf]Aq/m}h mh(m4H'EI*f8`d|¬/V_/T˚p^ߧPhQݼ# drCpPv$wO6=>6o^dI͵9jNC&*DX9r%wOOM횞 ۶WrN,߼uC9ݻvMѨiMm4e$x]iB?JbUT.,/kzV my8g l>}ۂ z|e2_|3;f 2uDF9!VÜet9$'wKh6ktI u5ֽ[.mr"cEFŵU"BT5""파IjY/2j|%Y˰P5EӈP/FYO!̗WϪEWphSBL >1Z|O! C;ӬmiP0hKP( BP( BP( BP( BP( BP( BP( BP( BP( BP( BP( BP( BP( BP( BP( BP( BP( BP( BP( BP( BP( BP(@c58"¥#e/uuNt AĄ@C础~(L=&"hۏk"]GC A*ڀ\'揵b#*cu⮳w]g/ڽ]~wuwש]~wm1uE%;.//(]驘XVV\TX]ZR3tgB^gbErlQ=,Ux *ʊRRU%z K\F3Z!j?)+/-_(,$Xs.-PT<(l&EJ'Q}iIq'p(Y2_UkVTWckz'T$W,PVZW^$W-(\R\WpUaR+&Vz mZ1c .?ю쒪@@dBy>cFɚ;*@Bg.ȃJy@?R W+GUP0Z֊.s,C6gs>*a,Yi+ͳ˶@f r/Jev](r9ZaߩccDYɥ|N<(2PFNb;BmB)ErD*3";\y*V rd>v{U( ;=KXra=Bdŕ;GZȢ@@?]flYFu\:b{G֬KuΨOO#Czjev@ɗ|?~'?N|{Upų^o'[ 8+e=?ؙȱr=u"ܕvpi?ջ;`v/zeikZ G&;/u]Vϥ4`kwUO2zj/=KybQ eK_NzzG']lwlluQCWeM}!\RWO]\H j:Ԥ'ummrtZO~\:KOГZb͡V^ZߝZ".LzokzSu7&uxs\EW:]^?2ʿA'T@Z׆֬?*-n_ZrkAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA)NFH٦a (݁@p!u@z/ wԍw_ o ćƇ]oGDXAIu/FZ۷##xvY+![ۿ,>*ʎQ7>bt}{@|tel;~O cX+>8vY|zv|j qqqvcevş ğח^/%"T 2؎XuE0 wuEk a_WDd(ȿW.@_:ZK?:ZHQ9La=Udj0 8vm>ȯJ40o:I N;3@M e0ж̶v츲Pnl{mgM*,oE}^iמîJ`C_dH^8^n̙U{|{~=v__;p>˼2SiMtsy9ӼŜe6o5o3o7s;;ͻ̻y|syм\d.67K͇Ger1s\e6261535 ZE%s`n4_67-V5s|||||||||a4?2wO=g^s<`~e~m415#wQ{GyJFЁtͥ:5I)eSAat8^MGk::Q4B:ciGb:RZF崂V҉tLoUt JMt:Ao3-tMo:Awѻ<:C{Bz]D}>D҇#t}.q}j}>Cj<]C_k%F2D_t J_v:}Iߢow=>~HwН#~L?t~N} ~IЯ ~KL z+yz^5 9Y f!BTfa,EHŢY eXgY֐5bY֔5cY a-Y+Z6,eIKfY :N,ufi,ua]Y7֝`=Y/֛a,eY,~3#Lc@6φ0d1ƙ`C06]Ůf#5Zv( X!ưcY1JX)+c׳rV*D6Mf7*6Me؍&6`76fl`wla ؽl!-bl {=bK=ʖ 8{=VUl5{=͞aϲX5{a/E[ֳ l#{mbWfmeml;{do;]{}>d;N>fS}>g{>ϾdWkv}þeav}ǎGv~f;N βs<.<\*w0#x$w;]n>^~?a_c|?+*?şgs?Z"7W|3·6o.?|'On)?|_+5?ȿC0?¿G#??_q~i~g9~_yN$EpPUE"RDh#bE='E}@4DcD4DsBxDKJ$֢HmEh'E{":HEH]DWMt=DOK}D}E9'1Az 4$H  qź깚Z<WkW[W+Jwuquupvque.\\!.uV”%V)J}Pi4V*͔J ţTZ) JkUd]V2dJT(sʽ}ber@9Q)ǕIrZ9U) EFաVϫkԵK:uAݨnR_Q_U7[ԭk6uCݩ~R?V?Qw{ս> uz@JZ=~~RGԣ1'gzB=ROg_Գ9zAָp;A`wx$cYƣ3XxOfX:㩌3e6Ll#w̫3ɬʜ95sZ捙7en޷ogf˾] Qr6ly9gSW[[x~w3޽ޯ_{zy={{{B6^mmm{M۾w|ȷnߧ=|};߷Cþ#|G}~Wos A$"D!*q0N"H$"$Ēz$ēiHƤ iFV$!I&I H:Tҙt҅t%Hw҃$Ho҇dLҗdlC/O|  K?BtbP' %pr אkud$#H>) d4Cƒ"2'd)!\OI$$2@2L#7d$YdK w<2C{BrYDyFi5l#gx f 0\c7aA fpCCap*:cg2 Bc1kF1(1J2zܨ0042ˌGc q IcXg76M+ƫfcxfl7v{kq8l13???')q8k3F tAfbPS1UmfeF1fYό3f_y\WOWͥMdA6 *v!nU]u(q55ƨ1(1FDgEcW% h1FMLqKFq&U,>ooO]~=sέ {#(oso7m{V$okۛMzӼޱ`r]T'0.⊸>(n7-pg_xGI|&^/_Ə*/}|>>#|LYg6S>|-s<<<<<<\e6ךϛYl(udQ,a Dt\Br:Krr||#|}}}N;w߃~{ġ^BH2!I:/"^r\V~______2~[o:Ug~fX ^`8kOE*ku`D\+'O:/?[-oK m=m%Qɶe-öSs?.{=Ӟg/{y /WVG#ʑHwwx%َ%Վ-=ӎ+;GNg3љ,usV89sr8O88s^weq\a.+UZZu} &8S-~dN֫z fقdl@6vUCMU4E*#oH W>TYrNhYFB,EKFZS#KZ>BKghc.ꮫuՕ+u£Bk ud(a2HyIF\=ڕFt1^ %hY.,RO#rDRUh)ҳZgZWk}6ޛtQo5+h}>Anc9䰁Er@#9a #9Gz]W7tuSWwT5 }LWiھ^O!o j mT*8!s^%M'|o !@Gr@.#schꪮꦮnꎮ~}]ߞd/F5=C! !{Mj^W #@\5$ zB=GWEC{ԕhO hِM)g d2d@2Rt]UfVC_I=KƕkZ:OדZ$  (cH7*|-5%>N_ܤiI'd jنdT#1$;h1va M^]A]Q]g:iů y|䜁Gr@E|䇆%!T$I?)n D@|j !Hh2čF}x+߯6ؒvM&lE@: 3$U?]j63f4ܓ7 0MH^4-H6$c:LktlS]]Q]BiC_"|䬁C\@rQAC4I4eܓ~Kd l H&4DSz46EWt ݫB ?Q2آ6ɐMDIB@H*4@Oj?Ԋ =5h^r.HnHK$7 $-p gMU]*CWmuru^Wy`T!"$] I/xh ^Aۆ~1W5אb # = ]iֽ @|RG#!+ %+JhA>&C|-ZzFfZmd$jR I 7GA29HB 9B@RKj!|F>4r\tr܆, !.+ѐ[-BI]DԻ<| <<[Ϸss :{~=?BOy~ ]==ssyyAwyy=== Y0)xd!S*9vB;-t:@/BG#:   ]T&tgB/z+xa `OCB( `P&Yp.L--( yu`Fw~PQXceslqo*tF\/ō0^,nŭV n+qLw;a[ OOUqxH<S#x]kaxB<ot_axV< 77xQ3K%xK2I&%Y%+-9%'̖HM`Tj s )ޑIOR JR8̓"H/5{RK-@j)?KR",$-a!eR)>Ka/RI,HJ)ދދJV7X^+zy=|"o7y[孰N.oylw;a6{彰E/!lG`|L>)"j3)- y-ߗwwT*>S,+D!p@*V8R+.G%*J S`UB8+pBT"3>Wx8RZ)ŭ N+J:E(EK_)%J 44X 8i< 4&ED[nDSi*|Oi:@3i&\Y4 ~94vD;pBF*uZLA{M*R~Km:N;t"wd:~SJ=:Nt:h%_L:YtFgΥs].Χw>}bxLҥ&r+M]MWx3У/&?\QƬn噫~YmOcfڪTV7oϷwii0jͷ`o5?k~SXco5?k~(0ᤷZ#GaoNJ՚5?k~DH7L(߉Cށ7PHWgg8 Y@Y@YbgX{j/3dZbXSG(Ӿ. < zļLf ެ=gX_֏gY6 d`6lFl{h`/1l,^bl{Mdd*^cSl{Mg3X%{doYm6as;O]6gg[>`هl [ʖrUlf5l-[ֳ l#6-l+ƶjհlO^gz/NNs9`Wk`qR'ssX\n|] \ ι΁*X]]IjT=pV,pΠAt*4 6 x}zh,Y6l. B[R B/^п" 2|U*Gڡy; ёii b#'ENK#B\ȇ2*'*nE݂gBhBR9:&"&11)11&gLOHY bb =fwnȈU7Ȍڶ88dS-g__7A⿂ !݄w!/넯!?Q#(H9hOCİ0XXA $KBAA;͝]ݕJ(NNKNn3g@EɋGrur5LSxbJZJH)GR ߆9}j{PR7nz4([wAIZYZ<6>mUlu%7[-Tۤ~NqgTR<_WG-KGNT>9ԪN|{ߓW>/ϗL =Ï'|Q)?G++x ?{Hg_d˿W6|g?֏jC Bu 6XذŅچ= c{f 3($. օXVYG}unbuOO=:IYqBib_.\벵b>uх†+u4T)lIiE}K:QosHR endstream endobj 14 0 obj <>stream h,] 0ʹ9l ."bRyޗ92 @rcZuV!Gnn[ T[vFc (F6/}g\=E˩psF1a/ Efy(+oV׎`\Yit-( X,Eyce4;(W̞z/a:>q 0G endstream endobj 15 0 obj <>/MediaBox[0 0 595.2 842.4]/Parent 959 0 R/Resources<>/Font<>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI]/XObject<>>>/Rotate 0/StructParents 36/Tabs/S/Type/Page>> endobj 16 0 obj <>stream x]o6=@^XbY$AIz%@w}g(qFD )y|Inf8_$?^]曋j 4k9?Y$/>g9Ӻj<)2.dV$7>3Y=vxkL'ǧϟ 3ODRND_>?[THԕ9Mrswu/?<MZU^]^,IOzg#m 怃*!~E}.ݓ6bIT>EZVx#^CMZ{ \%e+wkpƋfk͎D,k迄7H2k>D2J&kScQU&{mt{5'aP>]e#eRɫG~Į7Uܴ^7_fZL{Bg*)DV V`TyZJ#r+RȮd0я/||u̖/aE5DIap*>#50Zˊ1O6X==;K6nRYԣD)Tu15& OA77SOи۴*,US 8'm\qc6.jLU ~YΘvstv4ddhi\p 8Tyabt=}imOJBC4ܦ?ru}t ~sR#OUœT Bj!ax"B0w63S^Fp6n {,Xo`Bi􄳐΄boRP+A,і^f'WKlU6q4Pb*UJ :Nk3`h:0ގ .F#9eY#:0S4>ՁsY@A v(=꠨Y{߮=?%ٌ7}(ހl}Ċ=wE;o @)cO\BālN+.c8SFdmbȍgJGV-[M|mTJ@2D7ȡ=)euIM!fZ-Tv桉f:lG{}_"EᗎI0VEI?QBt=ɣu_Θsj~1<$ E#@0"h?҇eZg1(['󿁋5S1W"sGb8H8 j%;^ٴ{ǐݒͦ!pǂe}yG>&]u1w<&1~N2N)["M ّ3|mٻA#xbu'd{Uf Cye746i]aUcd*mja":`a7^&_EYí'KQgMcCD H(0ql(2+G7Yְ"i| 6R/㱋eڼ oA))#0y +J㚧{_žݖCTm+i*LO zZ<~b] cv# u f|WZC*p+äm-O.5..r8HPJgrۅ^Qm| ӡ`0;{4I +$e tw^d2"is'QqXвC*hhWv0+L*Öxq<M<vᑼtKI_ <ڃ{o-TOY7u³;?ֵ31|)a_p&j ] [8SItgu81^4q/EYB;}գ]['~Ysbuɀ˷(ڗ@${ox+&䙎nt|{hMХ͟n .P|>45`>_Mڛ<+M<jFԙ) z>p]H޳o[}i#4ܤ )PpHcReOƈf5_`;62-+ިϸ7W)mQz QO/e8S%ar pdm)UjT{[mZVk4}*1sP.|t{mbN|uQYwlwpOBְ<!}_0 qYDժFEC^}3B-h)|嬥`5&dRI.o?v3*pOP,,R'(&v[CXfI׳feՊ.|1 n1Yͽ}ְq=48m͙UIZcsYhm8jhnV p~ZgHn$Fq ʄH@|x7%tZq[;(; ,-N&4&P59c0 -%vJop?vM LJW[!ovU<.V-6_ەضY RS|h < ҝ |nKY}ƼngI30.{Gsvk=~f)_i{0l { 24IJ)BZ9S6o[YI.`E~hܶf|.Ƃ5c%U<Ӹ! ]UkM v-8W$ Ē4xư\؎mYňMT,eAX"|e˶:mz kjfF {6i~J.%p2oOsz2rhc!!$?Y= $"=5u;~GI{IYbll|>stream JFIF``C    $.' ",#(7),01444'9=82<.342C  2!!22222222222222222222222222222222222222222222222222" }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( +>)?c- ~c}y"W=f/kyĊU]+v;֞hY"&SgHNr\ zŎߕVvcU7V2PCRiQEGQE#2bTdp XJ^GY]20ʲ=E;4+QE!m M<KF MSNbIvb4(C (2kZT2rvi"2>f6/QP][EE<`tNg"=6G K`?@QY?%?Ə?NWFZSiZTҬQjvo#*I>f0/QEQEQE}~?i r@i3M:y'fiebuv q gR\r$q5?jimW~$%܉߼"5]X ?JSi>>7ĭag֓A;t$y?xtzFmGķ\4=8_窜)Iَ+^†[.w9]?Ꮛ5Dg u '>Mtp6?+FRԦ2K;d? ?կR3`i5 \-_Y) wyz+ߴ]jTZ7SXv"6cMZ, ?t?yɢ=>W?cXDO '0m(Ƭ9GJ%>:A5z??O*{#^(_&^(]DŽݚQEp#?Iί1+zc_bW߅?¿AL <Eoc|5[j&&ĉ$CG_RYjwLZ)/4HN\d1Xb)foB4lFxլl;ܻEWQEQE5/lgHDJdt CcקQ()4xld"5c 5i$͸D6^$]6HRcSy1B[NʭmnaA$ xz2k~^>:X)QI+&TJuNvaOΒ k0ǚ|W70sq P@5/*v}Vl }]OPáZA5z??O*{#^(_&^(]DŽݚQEp#?Iί1+24UE :+) t?5a_Bg'F8EXO=_+ `D6ӴI5<1I\9Tt:O^'B=Fȉov{o?/MO?5+7 Vo&:~GO%s%ã]?,roMsU_jV:DO 3q{) cuVpJp˿exߴkm_k^4uI.-9 FȠWI C_jsᆋf=RPxՔ,!^FD'VI~ЧUI6+ ( ( (<ztE6FC\߉K7f7^^ ݿJyz̲^iR:Z0=XTJJ\;=7aL@aSE=&&U/AcQx5_HV;Ғ/ %VyROOߘ^ڦܦHJҕs8O]Ki&I$Bq){+S¿4XiFt+B_*bLtI˞Ug@Z{IULrxRs·z=?J: Ix-kq oݲj?M_^Jty0 xik514aӶ6S~+WU޻ o BwcV3W˹%[_c$Wv?!B׍t{e:>(ԭglE2;b~p'y0iBRiEWώzO_SW_5oZ..D6 #ӆωU_AJ$TRq fK DD'kyo`WZ/ִ{Eteb=\ %2S,w::+Ǻi3]xG*=}߅Mm2MBVcBpE=$^1 1^ |=qӌ%%tg):3 0`TQEQEQEQEQEQEQEQEy'uu/viږiL< Տz\ܑm ZGt%b$w?tk٬q5mû.?Sg֙q8 #t=A[0Ty^kzYl| s}<}qx/I<{V#~*K/ VAO]] =jhd}vƬĐ>TR_1ӦG|NoR=.t2\F<}Kk6wqRk`3߽zOTԮ/ubŭ; 8=;|Gk( ˆx>5yU9_]=4z;z Rq>4i=gAգ^/}^zjs {8?GxkJk=Vݾgds>coƺ~(x Z~cmÍeZOG\63B${G 9|9ƳO_X<30';U+:.]|2n䜎)Te-?QӃSOKQyTr|=T^ӧ_6I>q´, :qӷ-t>(đ'i-S? 34䀤`~h/֝zW"ƞbvJOq+}4m؂BӞcR]i7qKJ%!_(˯{?|UaWKh*znǷT}~VlEKYc|_&okV7K"5!BC`^ o-=]qn?JT 0yoCwψZPiD:e :؏z~/xŶح[x*p1ֺc* Iӗt\秵nOPmcu=$1nUVqƓy&3w,o;1lV> X^A$VI4Bgi t6P/F.ugr=?Dž𿆶]Ʃ}u!u;;*~sN-ߨQ\HQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQE endstream endobj 18 0 obj <>/Font<>/XObject<>>>/Subtype/Form/Type/XObject>>stream x}K%7ݾwYo >nuGXKj ЏʆpsjO/.d2`7?]n֣Y#lZ9GgZ߿+՞zu43#X:=W߮?w;0[ԕr~ڞV?<F|g=Ө>u~@#=s7~?W~G1_Pϰ3ce[Q9cFۥUl;hutgs:3+8-9~6>ۖFNY㙒=w8z9{{XU4L[~YJυ}Ӈ _G L}rx.vM`w"T`HPsNoGuh`J{&G>E:Э:*;T90b"Ԏʎݧ8@?:2N'J9ՖnZ;ұw$΃Z;V:F 2u@A5Ažd-:wbFpljټ&> Bvh5|~Jr ,d{V%qFcwB5pݡc8X9-1{9K; aqoy (!pnHB}pB]G؏ y#d!!|o |c!oL\5v(] E"렧Un m&wn &kK݇>u0׸z=8Gd7om>|KL/O[3*耖+39!Q\%D#"^v1sEUTB\d!7;sq';BFʎXESH|_, ǣ_7EPCAŽ Y|he :6U-khY!"jBq`'rIGD1^SpQ CVl{`bQy6pR" "a8P'-D44WsB 4X`ZL?uX ɶ© jKk֜?Ä XOKٵ wnל{Daߌǀ9}OWa usਰI кvX'4Qia+N؏ϻ[qpp(1G#xGa(P-JmJs;M h;6gwe[8tC bIvrҩDq`hN_0e˺XCƈd/9l̩c38lԢ͍y[£djfsKLf/ =;Zo7?zo::4QW:tvEv{[W؅j\'rQV.!9̛!џ!=$n =8wH23 (+>/!NZzp \ح@ɘjCO@GT \8U)v)BPC \V֫c v.UX1;ئbFn=>5;tr(ݏlK9D{M:W4У#WJͽ*=XcT}IӾ-ML upa!qaA%7r#LQ1Y~9,I"hŽ*,Ib?d?ț:M~`"4kehl<mys2`uo^,Ài7`^ulh8X~8"n[j3+%"M|*t H/Iͺ%(:vKX}NL:4GZ}8nU@ީ[WխM}.|h$$u֡ՄR{wEյCq޼K[ ज़RrN[ V!a8Svr]׵t(ם\AW~8!+;J50.q1 ? +jnMhJ!`fDJUmЁu GʳoWv)`Ϥ!ߦZv) OV$1չ< b9}ṶSupg)!]@qZxֆQWcTrLdIy\X7\j}-h;N@u^ ITE(nUpp&r6X$oǘ9 #Ur-/  +zUV-*A\ /9;"*$wdzCIw=kvn 3xDž- '=qWbrv[+` Sn`Ÿ曓@MY_A6O5f.ulYeFz!vؠ-O¡zb)3~p V*1s%T3HA W &BYNXqI( F)C jCz?c%".yjV.jه9cG)B6'aq351œ-,\:pC˜ejޗd頱H-F=,.gŨ1Xs5F\"VT Pq-G4xʶ3c"BpE%} AZQbsʎPַ-݌΁3?,(Z2*Zeu0;}p7]i1=vE"4^|\ɉM`8rn_lb@Eϖx m>tb'w>5oG#1/̃k#$:`Gk|*4x9tU*9n W\ /qyDqoM66֙[ QF!FbcJ6/w]ĉykpb8 ZJjq{D8]]8XJ!۸gktO#͙3׎nlсKvI2ZC`G@f?N(Cl6apCgμ$uڹ#qZhib5:&0_Ќ/0* J7W\U 1kbeB"p;\"iH$r1]˥;s9"r=>3MQx -c)nŗy򾙈 }r֗񗲞C%[0Dv (IeMj%5ؾ(ECc|yK\IEs.: haV YS[Mэ >a.A.Yv!ڙ0qB@ǍmҼ"yoPSܩe ]fi.;4Maq Xx%+yWU3hA̋-'hZ`(BA@dRPvf*SFZQ )؉@$~/E`^8ZaCy):>悋,_;DGBFB 66@pQ؁4Z"EKĺXwkH! Ex)1_ TI2"UvY<iTJ]@h[dʕmR˱t&Mc W!}h)KQy>v3RDS[VYFI/- bۗ䱗ܛ-hG;ȼ3gA|׏&]{0+#/PQq V7ܐ[p9 I:"1eyeՍԩ3H@𩲵ʱp5m %=\Ӗ4nx$jEk2Bqrz[ڝ4.vTJ[CDJRPYj0 CQ.5LĐF2QyQ xn&$WB@8E`K3;X|K+<`Z Wqݖ "Un[v-h"MrbFt4-AvZUTإOqpJ ٌ7<0Z)yhե9mw4"D8S}4(d& Ҽx@3+lC+~&M qCp`kNVXT]Cel obQ] ZEZYP_!@J{_GZekkSTJTyKM=Qfi@ V(JBc9@rIH-w+Y$מ8QSMFW*1cVUK8R0+U(tVqDB]cMe|qELmrM#tiÕp$KѩJ{P{PC]`#Ttt:&E'NgJ0 Cz,EJT6H ֆ c,>uy^|nk3A'u!V/" nWydؒVѨ;k[R:6)EغXԅ/,3OU/I*1z{UnLf<-1%]߮6d3M[SykەՑˡN|mf_v)~_6Ä= =Q-RbD#SNǝeE++x\YyyUVY *S,{m_i]v>Pw7vxD͟bG:iGƗL⵩S vm;!֘'K@Td] WOI@N܎^oV+hel8NWuwң+DCAeR8y;}i>uIGj;x `|D#y^KQr%Lٚ*/,$?ܧ:\Pj;{Eg!c`1&`Jl"OݲC#L4R56L!.C+kԡm P@PqWtWAP҄IY~RpLJEQ#ŧ*e@=O9nnMte;e"9ZpT:R Mi"=bkg,XV!b~f(IN_x«ˑ_K!CY+^dC1#)8K,}RqFO=0,K3!P5"Du48bL؞C%#x ZQK+)"vKT^QM鮒>Q߈'ĶW~N¹B&\ӈB؄tY.Ӷu0\8e[ԖS_L{ŦT& GWL{XyWG G^ 2}t, aY{XEL]Uc*~aƺ@R/lEɈ h/g_VG*mU/ gNe;~~kZ*^VTIepZǧM*_oEvݡz:ss!=mV>is=;:Iu [Ŕ"Z NDr';xԫҫuIU, r*I3+:R,^\;zxr~LAu6*AI`C.|ʚZt#h Ye&2 c"EvI#ipۉ)xeh.GEWP{MZ#Ъ*IԒzm1MlTol)m:B$P֤C]L`j, [_0*s:Y|,QE(N,9΅-/ÊW,ݕx *6(>f+n[NCO,uG(e블:/pGA3JL|RhU&:(QoUkmʨ\UNɃm=#?~~QTfrH*e0始(P VؘdUcW'fӡDb Pcj^F WLt4 :\eU?ZIE,~67-h1^JRCw>z՛i,ҪۧBhXbvas,4* i*EaZT6̰#gVT<5!{QүXpXt **[jP3pHV0ENryB]U0Pk@> Y$L3IxT \t:%eUQb &ⷐr;SgCSQ.$C<2ZyFQ/dbjT V1pmJ*KoM.Q̈́kJSܘYU[Y'E*qaԡgTen"ʣiVq Pv-ZޟDpVX(spp[_*2l9DɡXU+J"!M5f Urf()(T,¨/YuV-EE^ÿY5%;co$lϻ3\nbb2)W|0Fb]U^ rHl=/YuXzjn]"5T7=[! kj Q4PGYa][v*c fRI U IςMJZzu:"9XTRJ8J3L0!E6 XVPp5U3xcK_}T*_eahsBGD6%ZX j U??bS;EܟTCc.6qJo1C ?^}g525@ogUO+LTa5Yj j_ڎkTchwP;WJD1s[ޙ>YZhO-T AhZnY'Zi"8}LDKfB |ߩ&|nhIc4yq}B'BB `K~)}#|Uro:i+^[Dcͅ[:عѐ dF iP4\ |&'jvdDBPF`C\hJ]C&6M*ESiD`g}&S8xKϫ|1/[dNdžﵷiEͶGyz+Ex)F)T|ck1FzGv\)5ܣcg9)2ڮA_&OהNiv *ۊ5%nOxPI#,$h) @Lb ̡5ܫgWۉHZyC9?)G&V~AlgjD3XV2I'ű,$,dX*Y!ݿ`o펼9 E2< Y^7b'Tobg4Myg)•ZOڶjU?ޗ"gXdR'N*;-*׉q8xW߿ԯJ?~N#DklB~g0hoկڇ?w %7k%ﰄoկJ߾Br۳ ]:~կqE~H WI[_*7O| PPP̚k_}o?"tDeD| $5/%W:V/_?ŷ?x7!g6%nA?u _`3qȿ^_;_UBcDT?~V$mc4G7G|>gͧ?~-t{ endstream endobj 19 0 obj <>/MediaBox[0 0 595.2 842.4]/Parent 959 0 R/Resources<>/Font<>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI]>>/Rotate 0/StructParents 40/Tabs/S/Type/Page>> endobj 20 0 obj <>stream x][o~70$zN lCYecbKI/ݬ"Y=Ȼ3="Y,_n?}8=_ޞ}8<ϧNo?]_=Nj/''_mI]aMiǶқUr_kswO}gX^J,͸1 AeW U;nTݙYlTXmbq Kcc:g_w.0w=Xjv7cu'vZܿC6'nI7jG.)wtCMx<^c?nz)0?{3}oOo_SDx;Dhl/,OٝgtsW h\=b̚2kQ 7,11GU4;#fQoK)`ZU#32V)` GiNwt\a@ 3O,1|m 5)=t*VsdR&1 k+TK0U= ߗM.1msB4[MSu\[,MͲVEhk[]% wߑH*'}3;4KiC>"0,1b@s9`L;?Hw3oBmھւ I.a#c' oȭ>:fqzU[ ::ko9a#YaTJwdE:r9ea*ENMu* Ag/ȔvO$$TQA=? { g3,,Lc!Rc26 _cgŹp`g.-ڥ%1QzaW{(\6rv#9kvt2ddֆIf/?Kɲy2%9Ŧs.Uq l$  4CZ.!xI*%IXa` UǵE;o_#6՚fC8&筑,N-MܵM{Nӏ.  Fq|' |W>M]t/D4]@2g9˼qYd#꠴g-HEo}[&k)r}wnfsOAE)cG4gp)nVU k>r Jz\{ɶhŝ!| c tB"z%rIx^rɀCN~L_/ԊM>d5qvM34@j=˿bٜ'{M56-@ nUxq,;CFQDe]}Nf5ת,S8XNQ\[Y b@b͈B6Lǎ|zj5eᾧtp`Rimy>T4H@fŗ\/}_)vW,B03b$pW+D C.ް6y!mu c2J YRQL4s9<C-K𕾉ՠmZ{e}' mrE|e {hVjrYma}%ӼeqF6m8x:# 4iWgΙ~hj~inȪT=2e MQ![ei4F!QNJ[)hZ; 3R|#VedRf$OA)aHi A#U Pw@fa 4yZN-Jgg\Cɯ02AFn2O(5&6K^q^Gh'OV`RN kJFMhWb 2vSs3*/Bɱ( & p0_^(WMkp' TBB[SX-Z6uU͊%9)BшR}pJOWQ\VU7^ TA{j@Bt\H#Ri KG箼^Uӷx;D.-G,K0/Ady$@]Jꋧ `t"9@Cr.bb]{:)SdOwj$G3얬_7D&T?KY4uVÒ1B*eCʺbG=uoh*hUIL񦂇`xi˛"Rr+]g1O1eL!(PL#/P\PL>4Uob5a\5^2P/1m*S؋E.vK#`<d Q tU_T7?+N+Db;rӋyYqCg\ R2jPn,ᰟ ,=Bg>: PHw.q59ދw91 *=0p(Tv.8|CY̘ hV;u0,݌TN0:ih*t.=*,@T'=Z[CBqtL7yYۜ+] ?XC^܇~_;,}肭k<`*;*o:JLc'Q[m;\=TVr. 3U۰w\w:CeruvZ ZkG/ֺ2Q}ed0ӎb7 cYGZ)w)56O)!:J@$p7<`zfe59' u!J\pk1m+Y>Ai{D8;K~Ov}j1] orξe:*=;[H94`~ endstream endobj 21 0 obj <>stream hެj1_e^@flv " MK-ab`]4iڻ2$9|!4H`:r467sGj%;{P8&R.:c$.}?)KJ7Iܚ3㒻{ך4ЂWtmz1]oA)ܘ{!=?~>/MediaBox[0 0 595.2 842.4]/Parent 959 0 R/Resources<>/Font<>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI]/XObject<>>>/Rotate 0/StructParents 42/Tabs/S/Type/Page>> endobj 23 0 obj <>stream xn7݀aEDC\]$@vc`>ȶxX-w7!9䌜,ͅs!s~j_~}qs]rvzvy9{[owg/7yӓ?)+H%Aߜoɋӓ7HV`d]᪡'O jDПLU7LO',.X[xO,?NO^k<=[(78`bQ 8>,)^<.W-/kvwYťn7KQ/>g0*}R {AW!ݎ..Xlhn|{3oEyDG,*;QD*Ƃ@} kR',_!U~:ؕ~)oZl/3-z|,FbH18"m'hy$HޛzWU}v}wS-6w^,cjz k#L#Zj~q˂Y*,DN,Nr~k/WX 97;o+ 16+̅JW"($ tda6&VJu+ul먛x%ͤH=)#ͯ]2v a"2L"? JT.Ca6Scr7_T/ 7ٌloeTA0Nh–gSz' Mi9AȹhUJ_f[7Zԃl,G< ֺgӃacd-3} de_qo_ClYZ[V|xeA-J?1Ti8 -ݏV%=P%!,{6G,3[Ds厽%+XױL;;.F:.xxo &Q7%mxm:nt<$fHຐ0*ΈgQ5e0.ӡ_N_؀cٳNd:؁)*ʘeI4+asCKO5F !XYnrBm[ q[#0Cy!vX:=7+w7b[YfЗQ_ށ׽vkw㝕gux]nz}ZÊjMcj?`2-`a9^J縎s5UJ ]|zH7H֩XޠXSĿLjyv2X*!NrDznΛRO \* aTvƑyBlGY"Tt̲r6Y,F"XO7Kк&=g@bHĵ3~8vlEb2d { FLj<}fA9 (G[xVQ*q"~lhHqP㋃aOʊ)%2X7o#(n,j9Si)Dt9^njxz[5H'y[x)ׯ`B&}LZH(JIXq ,*z›gH[z`ƶYGѾgoKͬ)WF|WND#5ыYIW##*i297eq!L<}t+ū@e1s`#qmJwnQ86myNf0m`/ټKH7X &L-|[=.q`9xOcoRquLnYAInVqerjKc`V<͆vﻆ^YNKN܄BL v졃`:qTl N >ԛdsu\<T/o/~`z^ovzީXx:/Ԓu oar ϸdSBD2_ő%2eT 袃h?ҫ?}O_ɬ:Q3[Ns$$Qɱ+wq<ܙHupZT~@P0 3["`9cxVM owsgzװ%ahz c~eS b h^nl!"$'FSWDKgc.z8\ÈSpXh)\W-lbdCr0~jY6hAZ-̀ܶQx~`csٽyJ*b84uђMUK36\%~͛ DTĎ(Ws3;YW Cj;PO3uknOX04Bw} $"qv6Τ[fGr˛/7IJubITi[Sl |-7<@<˚a"kS*\gh n;^߃MT̊i`Ղ]&^̚wT1Da6\biLWSh)*kTqAp$Ղv]y:.>f52{˓9%z[@47Ƨfvjh;С n !ώ~LXGXNd-Yý!+ag-#|S?To ,O%屆; a_NCS9K"CwPY8&FV:?IFF/r Vj]L3dBe9(j2\L;kӴ=*mW.nGnUvm O 7F4GJ@vB7mΩ{/(O5NZа}fvgx*,4V70C]?FvtQ+A;(?2?>Ԏ *q0X ?w]1qLX/8*>ZmU# TmN{3(Ei4aӷN&p+ϕcs_v6żN$EB2B>4G]1^N&,ǨA`uO:-JS,Pz!rЊ6!nxRVӎRVPŽ 9"都"H8ًd c58kmh2As\ 6*B뽉s^./?lJy*/՟jXX^sJfOˀ+:>/Font<>>>/Subtype/Form/Type/XObject>>stream x}[7r"c-1IPCc3M姱1Gn _`E{?Nn$*yN9eqjƢ}0=t ^wR%@GfVL ~pSdsb.b*_)V[5i`(@d)+0DJ403_кvS%g@!N q\Z #87B@B͌J4 4VÔ$(p,dZ,\Y,*m0G#@*" =bѶkky9^Yn|'_?ÚuڶҡVV6_S}|1a[ݳq|^_֋?_~ryqY.޾\jA x'_<]C_gM'TتcT>5gwW_ۻW_ Osm,CW|+<7\!&7뗋K2%SxG2GO~_5K9\a=\[mܹs}afqzpn%+$ݽlLkGRm;W _/>fg'L:?H׿bZ{kpI;G}juvcy4yV4-~^Z+<[n 7x WKmn.Ys?pS \}X.v[ݗ?e߽[헏B4* d=oBKxCkm/.OG'&m tcm5LRAm@Zm>uK[,-g ذ#־r?ֺ[[ʀM;&=̭ )bSٙ9cnriqcOǬ ߒpY^|)狛{l(Tرbe(!bګ.Sj$%eCI[;.H ɦpm7_NݗX.bS6`M5b dcMگK(wKs؆bh=`돌C@.#?N a @b7t1Y+( Cb$  ,Rhv(H;Q*!.(;ܦڒ[FP- fQ/  ~Z&CR0Ů;rY ^@+D ֝]e6rP4tMB݆ uL/>ɐUtК~iu#L|HkCkEɻ۸$&&AF0b RU*GT$DDVW;B@+&vbhDMYnWj*Z7bת@+qidK PD1QrbZU3ךR0`*sJ 6효asK~l yj blz2hU!wc$ (+sR$MFqE0Pӝ.^ F;$:O"~Dk%7Me zZWv%(x?t7IZH4v/N6_j:z)hX)LNWb LVOe꺰 O)m=gYV;Ml-.L#5U,Rlh;, =P>89"#d2SĤ,Ne_d 5{b+o_+?Er43pO-q!J4m)V!(vta gG#q7[kdf+{ 7f9RNG1{\Z8cf٘TYŇ\8y-pCy&`f>Y/0W@%S#V,k'xQEraZTi 3BQ_J`䆧dL-tܫ.V. h[ua =M(d4e /l`kt, Lzl⼓,?Vl"Fvi,vKMܢ}l;7})w-~cI݉E$e (ie0k8hiH_ޤgFoS6KI ݾpsu+ɭo֯o_r?0qFla~z L'h/7 Eqi0pqݮ83u ~Ӿ>JKW Y?IZpajW,/k6,S[ o1~XHAh-"RzJ N]Qe/M#1w$EG _/$CX8]|ךksپ\x~{&iUbONQ_ou*i$cjPHɹ@ő֦9JwZ/6(2:2:VJ2ZN媁Oڕd?@/#T/ns| ]ORrhᙊ,j+ RS[ ]v9ygbG+E&prey8]w,E3 UbF6d* @^OMl4Xe'j-T5CgRY BFm+mnT:hcorn *y]ߤMҨ`PbL>,r°fİ'Z:zB( iyŪѹR9'" F`cK ୄNfp5ސm甬ig&FH\V$i':5NQ+S7pv+o)*\Eaaq Il:V 8X}RS.~ZKILS@} t{6ǿ$?>:O 2 +& la"5a쏕0|`h??88uSPR !lLu)0 16+[gג4XpgovKc[SH|Űh8Jq*e|jtհjqXzYMAVDsBt%˜z7-Όlw s֍,~(V;G'F'fF |+)ީ3\RdV*:{Ȝq!nNE~ ͛Щiad"y^%,&X`ս6D1f33 V&*]rMo ,nGwVt[B\ؤ^V! -U.g{$辽F^joC_$ػ/%0WVƪ[%-_wwK5ńڙt =:s{ֵu=R,W^[/v@%?R1-e^yjl WsG_*/v'I]M@h8 8iq|m\~}p\L}(˫lo1SK"V:<~uᲥO EMC]`\V'Z"BZኧ^YM7x+mp~Q)z8n߾l̃x%j"%CiwgIcP$!Z$"lk^*"8h$}}g(iQ# {XyH_ҒG=xRdڶ߃_.y%2}֠)S(W2,7%XzÞ=\~˃^9^>N}Ϝ!yۏr=Srj~*9պdUɷxexrԖ,jK ᮤrSF8P+@=ֆw%˔<ɗ5/k2#'7DO6 {%-*tL}jvdX׸i9⧭0`G&*ً\G@A',taI<0*DCs6510s:#P-J]hP,ulL+fa=M87-[pPHS[ݳBB(NʺfM'OG}8 xYϡpLWIEo)0q;0.S%IG27JRHFS՟*{EΧa\6N;,$jLҷ-3m<Pm)غ^ݙv{u*APD RDA(W tQ 3,쉸BNmr!\$z)Gur nV&q $;0zrh0paqM%L>YL`CzlHO-iKX34CebJ[:3͖Nzْ\E0jg?o lJI_k7D]DD[|[8LVGJD:@- )ؠ{@͘)vΟ*%G.&&؉#' ,&Y k3IV ,*bYv\dar1I75Y\ͽvb<"Op :A usܕJVtn=(x ZdʭT⓸}(~`I ҆g8{?RFξFx~|?o7*ǑWpg`}eBs_(?ˆ'-gO]^%zjs6=E!+[v:iޣ9?g<>S?"r)'t&+q?eb˙'66Sgk Z]5D,8gDo3 !%7-5t^티0mq⭠^059jed*'edt B8 e"ddP͇XqNX:@Taqs܂)3ߤS[Sv29|qȡ_2rLUPʁO! ^+3sO f_Ҳb Xkȁcͬ,NgZHB1Z|`Xb.ovJv]c鞳!tE; @ @[:xx=Vr<.od#[>672 f_xmjZl] iWJhp J߳#: h;\X*}OQ{ 0RcXd$e-R̈-RHQTfѲXA;dt ==Z8UM|\|"QAWm91Q<8v' VߺQ0Q<#[0jV 119k{lՠ\ j*C=;[Eq.l^ЖЮ6 Ǥ5Q''7L /qΠ kJQ.ȵZ43bB@4?n杊`øNŒEhL3^ fǺhuɲAٲ>L dqr9$)o-p H"eUVPx7`aik0ebRқʱ'*)+8m֋?bfA_9dKTZ&)gg[(rLwo5r4U9;ƕNLfHbp>gqfsY~a}X HtbUY+o֝>XS=l+yYs(uM}E]NXlKP^IY}FEac Im,pM#d S-ѱIz/ڃ"6uZE,t"AХ|+*ðeLĨt{lbX!i0iOZjj=3v쁉TIq Qt q>1~E ǗmmSC.X:(ת)Џծ?9bgWZ.xMblF4#AXrK{I*YN="_lk˽ bٱP}vS5*E;AbqY 8Cbb%lF\θ#1`2XQ,A[qc*s˃n؞+ .)Dh*`+߲]^oh]'gI~9GtIVA1T.HhtG10`'`TAQ*[pXZPCDmű/jPZnz'}]rO#V¨Ц.uTHS}ġ'N`:ۛ{"a tzjVȉSz$*܃(. $'^gMe7 Æ'AYA4u Rr% 3\|̂ǚ01pdMS=< 7jZ"YqO[e+hyqqX#qaM[$z^uϝxs܋3ovv&P1ؐI:_17qy" h2̓Ҷ =Q%͕TZMf~-0C`n)T>ZLꎦmy# \dY-bSlP1}:(1>f1>+1d!<Ȁ@T2,7YA뭝ˆݑsY\d3TJl0d-Ed]:pnmj$k/,n;qG>5z>9dZdI_^8zem))[[*G^ꄙFߩSn9*\|'@N#o4~ ?$]y\y`dy 0<(U!@n&p",$"#S #v*q򁉼E"}r">{jP7Q=/f<4+?Y _e%|$W2sO1w:@t8m-pa:+򷾉 ը>Qv 6J8{w1 (\6:2tpr+삝ۛeG;?DKSford>.=<>,8nRf 0w=%HFdj:D@B@Q7H;j3J=)%hNRy} NE߅ GdjdKSÉ W3+# a"}t>$ŏdn U P<#H,}1H4adMJA@4O^T<¸Dņ9uR9Ė99 :b:Ŧ:(]va$卍ɣ,.z@b/ˏk,P3eY;oqJmD۹5}??篿çDf5SNSGZ?k)7Ĺ[@ݣ778S\șXŜºm^`Qc'%9 L_ΙIT7T0Qo , NRaF =4"K@B  #Qu"Kxry 2.#dg᩻"qOFN CD%{TE$&➝H~"oj&GYs05lHŲ H̺w 6ioYO&=z!g+6l¶-UW- ;vao0^b ԰bHl.-wgi0Q!x/(y b89O=3ɀ]FOoi*OL+r lq endstream endobj 25 0 obj <>/MediaBox[0 0 595.2 842.4]/Parent 959 0 R/Resources<>/Font<>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI]>>/Rotate 0/StructParents 46/Tabs/S/Type/Page>> endobj 26 0 obj <>stream x=]s6G͕E Krl٩{XeIk_,$ {f%*dwF嫯닏_ZW'N|u]uu~qZ_\]|wa t:=zt8ϟE u]/Eׅ^tFfg?{F-[w h]}_z{O Ti( 5׎~z˦9ey?.-|lOd{)%PՀʀֻen,:X/`_/Y;\b˦<~ˮqXRHwo.^,ʽmx?<+ 2YH>Dy'Jw}wE]6V @酲25E5 ZKA_WȢ~^_UiFML֋'rO@P,Ǟcmފ_a~yfEXte*AiREP (\C^;WG6<[u_OKOAX@UoeB- 1F5uC.;я~t[{],c%Bn:w{.Bg8>L7ԕt3 gyp;nwJpo% ccq,I8678dpl$! +\"8qcſU9⾝[2.8 s4 _Cǎo"HQ!#SoX8"''֊ y*X"naFbGq;(09;6"7 ˝ vUCjArhX%?+N5ax1KV^xsqíq h7TF" /^|=L5 k8*5fsXrez#*ĩsdׯ#=pq'f;Jws=QF.CHV]FHP(yUr..=#NYѩu ~D22qʑ+nrf']/ogvf ^R%!oCP'òLĝ?SaX`D`?c/go3*|#poޢ{r<ʫkybpحygA=d,\i!| uf)1<չ]90$N'خiӈ3 wTiG<q4F|2H]m"p]y9L# IL0Rn|QgXdnw5t uasm/e~#:@V-78ǘeWz&m|jڨ?F #adG">R5H&7NoǷvut߹R1/cL  *S$m1_g bt$XHӼі\D#Kk3: EIӂMôX0pPx*Re&w9 +Ug.Fo{2u;h-d,Pƃڧ ޳7U!"$IP="̕X.[c#VP87d#N\Y6ΠxROu@+cl}O+HB_= ]g` Q6gb"<ã|9ҦH&m,P>r[ĞC؂qQMQ5_D5[„{Fp L w[}ɫ: ؃ezԦh栘%0q]hU0I$T3^m}.P-;#U÷>|T+'jVdp;jVD|Ru y{3M*2 R;lc6J_Ҙ䶇*UO ' $&wCOd.qB?(Jn6-(@^@ν}| +1hNly*6.:6V( Rx/4aYac8WõKQ]GJ6ht1C3udNsNK31, -SB&l\OSߨB26ՈU;*_Ev96jfܠ)x7c#x̻*7hG9y,۸̴4ÜV;l]>a?l݀LH4;˼2L0ʽ˪`b; Ln/6|?HSJ̞B V^ Mrok T hƙtaÐ[57$`ҥ7 x%6Dw5!#c0ܴ5d7 6t õŨDwnF-#7b,V S5Va6Ї|p8F1w[dY 4bZnxٻmv\?P ܾsO]\tKfhv cnVuИ=+mL f<"+Ar(XPC̈́QU#(nRC˛~Ed`Acj>e8ESٜ\GK hDaN!7@ѱPIa*5tM8O奸]{ϹsxKeiY,<$|P%5)<D!RUca`|Mzҥx䮪V+DzdzhFLʀjz0L gav NB~;$Q7b\pc K=?jI܎q D`PKZW.oQXC{{)rUn۷`B .nW#9·st(UC{,찺`i>D܌ܰW*^Dnhܚ~Ֆyd Vf!knк#*sNW+ q~)GߴP؏;ĆbSC[tkTMV ~|gQZ02蜭ҡi9ٶ+f^@墺!)P[5|`ԨEʙkhuXx}=[+Yf>ԫ77[P;5ȑ L hո @7}Tb8ձ0je9N)n^At#3cnݴ 0sZ5T6K#n8*Y@O,/8Jv89C3?'@!$*W`28Ej-E4H$3{[De߱́q>KEp~-7;;V`Wqf[/\=IJ!WKqryfƝp(jp1#BMX576$g}T`XdO.ڀE+:#! D&rj3G̱DMZ `9 7rbfdpT^z:[7߬sdԥ#>9ܜ '0kKC=X ?S Wˬ'3ry܄Zۈذ\69FD9$!0 =!s j҇Y3#xXQ-؋MŰ6kXK'n4[*r!5ӹ"Z ʧ͵fJQZO#i N{:B$l; cbw2Ueb6pEf<(V.ADBPdi?R%{i3xhMK!ur{ϖ a=n3:qu;(po˴U!A7P^l םx`陪':.ŕqNldcͽϸHW.uMz7갢čz TK]VjWno;|%z Y-Z$TdXpX_oWq -9qh4Ohl5z8"xZ{mIVدp,56~womqWf}є'km5L˲OR%FrsKlE6qՃmfRlDm+ߌ1C輂 XC5?Mg]l֝RA$F 9zf2\(:QmݛYi-1M#0+d*䂛XݜN5‘::NsXm wUtwTCq3q,o ~z{tmL)4;w-1{E}p]bp*dEahw"[yzze\ESdteHHqҀ!"!)s^BV#5j !Bމd˧R7!gr64VH*i?Z(ژ靋aq)xSOu)0D δpZO.($ݠNLpFD<05'WXaㅇV9#.ӛp|=+9x ETUAV`D.)/]oKޖ'y6?o=X.Ѻ?-ط~MPLR]qlQWĉ'ٺl=C*wTnyR%ta-Y\,2*,Z_ӡ:!~9VN\NH/ȱ,RNj4@#7*oh~c ߫ۙl8anKZ)w(kNËYU "i4٩ŪЀ1nwFqAՃWbZ.X_ƌ9NCJ]n߿8n *={ˀ3' %{rPqʤm96 z'ðGU5kpc 6s7SZ\ʎznmӌW6-t-/AbbaGDqVIp> <09ϛrl$+jo~-M?!q{%jY+) huh\r3KR Gۏ_B}rf>/MediaBox[0 0 595.2 842.4]/Parent 959 0 R/Resources<>/Font<>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI]>>/Rotate 0/StructParents 47/Tabs/S/Type/Page>> endobj 28 0 obj <>stream x=n7fa H8E $ci,imhQ^b4l)2nU,ugl3曣fqv<|~}jZ~[/˯dzӿ勺}z Mg䕜}]|^8}6~LYجU7놡bwōnq>+޷Wi~w/_|üm~vsl?_Vߗ/DvP[kDq`ܠޱh vp;?ff~(ꃅ7+DYZnm}p[yv:釷u{j>kӚm_V#b]EiyS 'QفP scmŃmhjŏϘjbm% ]Cj폯gGrl_zykQC3Qn&YΩ! ?=F<EŒ{|'RffGoG?,VF%3@Ey'.לk961d; 'LJM.~zos|s|_C> ޫ LJ"Cfz=往u'Imiň>8gM#eaqYař߫y+j¥ՐZB-%>蛟ޫ#Ъ;k^hJǹ,_9Au]w"|UԊ١fe,bY.QBJf ~/s0k<doۿf`խü  amNx(2;#ϬPIPEcyf(g(#zG̐--CsJ~CS2+`ac}g }1X ԫNj{Y8m}̘Q -K Z]έWhNxg]&hel`M7z7eRqHSTpK( C[C4UǁW>DUg?F5@ 'pj#;/);^>CD'0Gڭ'%VyekbHY̋9Gb5H<q?|0Vsts<2`}ZXz]pSv>2%%* U+a]F n:GmcmC5hLSk4>40g;c A33k9Iqo8vβtMQxz,j3Ib_qLS*D$wApDWAڿQ/@X yxa$罉nI`>+ eƋsucR1l#:bsH}Ud>Aˁ1(gve_yk/6EGdbR8: ({N>ۆ}2LړE{VHw$0ƼO5}ɩrԲttΧC4)9#5|V 59X1-;di^#SqEglv[\Y#j9\A=D0""1.W}ч:.H(@&qn܀;lCb=XE)#N i K$ `قr (3K)Wm+:v偧 K+6+fy+X++.r}I΂&]C37D0}CA821M_ىP[mr`2|P=O0R PwxY}oP˼e4:y$HʧX ρ]JT70Цڒ~cg/'Jf8pl !>k}%jwv=/H={?9#[X_K2XS ނppQ\#^D_t:hZJsj/^4ʦ!t>b:c収jc.'Q ;2aZ8 :}LAϖK8@?ĉ!:ME)d!@́:HeÝ2[ޙDF=Z+6)9Wp "W &n4.k ~\]k&Cf@QJ=wt).5TMx.Pؚ<"\FxhKp Nj D;P2@6ZA5ui-qU]nn~NY݉=O2GdAثya?e M֟YȮ[y^ V~EҸ,,naTلdJwu!,# f"Ҥp@:DUL!>&%>'C@i$)G3=$TH!A?{KxjLWew^333X* O3%>KzӶ)gM C/fc{9U3ȊH5#kHIc ![y=hoR(Qvtp9{$y{"eT Yz-E,Pӡ޶RԿ5&p.Y tKdJ0[i ` ig( N$~i?޴D j@z ~4q묺 N!_aJP[c1U4\g]Q$Qf?:(ZO+dMeoel"I^fB_6\bSx^ wZp$rYXs=;ڟXY`Ϣ(t [v\8tΫ(%ZY,lf,fP={nPItEAލE_ i/: ܐx+5%"'͟ T@]@j!x;+Is)IJYI )\Nv$1v" Ҿ #HL[@F;- L_cq2IfJLOjpOn01ܾt}jQr">W,5BqZo~?oTÛx㲦FĎnP`J/^d!lj%Q/l2d}tIs鲰y ƾtKjuT. llLnޢ#!Ys @ŁTQHwMXmF6K6:GEV@~Ip –gZ%aGcף7rhAb*c-eT#HE I]9{4iHȑf 1;8w;[N3?bǶZ _hw·wEXjXxr=^0rRo&$e3+E Jf%@ @tS1Mə_ssH%"0uD"P,eOPAAEY'萈B+q@c] *Xo i|nB:D8 [L{2x7 v(Lsϲ!…|?;hnSﶳ/O'0znp\ƾcwuj.HUt8sA`/  PZ)`W.dFv'UJ;&en/6IES;5HSP \: B .]6Ezi80^xecϵ/ӎ} Ye&Kھe )y'$ObbWjZx< wY |55je9)zVT㈸1 '[슮袓5FLF%ۉPoC6ljR 3n]ؒ 4O{ăRa^xC@m4rzJ2PZ{ G"Idcl*S3xh '1 4*ĕ(>7m͋ 8›z]w\IkYJd`M!kD]aC@qID)BfQ2*!1W.,d6 'T抏>0_S iS c-'a}1^?Ƚ TIlzS85XT0Y`PLF)O 2>8һe[9TkCRD=̂Wpm,K+nӾ45B )"ؼcJ?C)Kɔp]ZPJqo}_u)]YєikI;3XB%dtJ4ʺ#&de9$};ŃSB{j3H)I٤O0x^+"'K&آ쓟 eg[H̙?vf5vKIliּLX(2u:9 r^M0Qn,q | 4k9/J6O%pJM;z-<9~TbzV!#2k𤰺ΕAjV;i2pk)~DAoh/} QUo2K*WNl?7577$i7$e!WXeC'z`ۦ>U=څO3 \ v-D{zHLlܽOiK4a]P)o5J4geI+LxN {SXWGo|H\; ?LӯgKI&KIBu ǺŮr&BɠvZu1+?G]ؽG 7zlXds=lMKi;!,GD48   9% B 6%ki9n)X8`q Ǔtqqf38reD-el}?DC@jz4:˶O΃rM'NpMC.):+qU=0쯊'zjp ܠ4d{޶4fp"P/CF'XtFYBB-|bBI߄ډv<2Qe5?d =ɞ9NI9g+gQȴyzȚoro{\u$D\ 4h@d5t*^W(&(瞅c H[}t~4, .2?{9$eX<ߗ592V^{P22e6mT⹰u@e fb-Pt ͳ$1dYO̡jA-VMEEG {Oƙ~ݫYa>pe:t{xڧt\~{ RUo M8(w Dr9MO.kftI*}Ѿ2d;芍"e?s#UK戶L/ Ѯ~6Lnx۞Uz=jdԑ7m{dDeVw_9'Foһ/ ŰЍQ.KwSj]5Sufǭ9pHJƎw;e䙧3!~1\'Gg)_7S&%vI `tr?_^wU\!$O7tHy /NL'&)mSZ3 |!"g`V0JH&v(C4-IOw- Md=:4K`zdd6>huq?:8l6fjZ~[o+3ݓsO~!rhP,elrjɾDCe}-nU7 }s0ISTFK"ğR{+3A[',)q(Uj~X2ҽ nTf>)@܅l3w{\~toV.M,n-h?lF`(g)ʙ>Z>3]Q:lZ77ji)|3W\_׹7kyι@7a54g^;g^z,6gW%jiA[!ژ۶)"jyȦo_kD2LQK ~dݡV L}^;,aa$b0"bݺt<LO8d{ø>15 u֫B4N:>gWi̜t7RLMWwl1.jrcNh[nӎȣGgT1K.\hM߆\͢!C Q8:5 hsw#UtM/ `!n؇`>. 8sʍF LQ i,:#_/O!$u~Ԅ n.EKvgj#;&/VmrPLN9/@^T }L*dSbe#‘Y9|g4uW$O xv4(~2Z$|OD/ ;8++G#2T_zY!UѦu͜9i(N׿߁ *[+p<7/EO /ޙ/ vI[ YИa5q,h4~!/Ǵ$ fj+тUW?Jl 7 Ta};HVTSe1¼\w)DADIDPQ{Jnuûzm)Imk60*>I;> Jeq)#\BjC 1hѲPġ1?e@1bQT oua>R-0,W%uTW\=-,IJ{ch= c !me༟=q7= ș|5u ήPh$.׿ըGϖ-u*yw 2o#F+.-к8;m gݱHnV2{x"$yӱ t:Ę̨I,HH,GM<\Ư>/GE}a經dqW_1)o*ފ~~,#OɐODctPiKm"K4ks?@vnJW;3R endstream endobj 29 0 obj <>/MediaBox[0 0 595.2 842.4]/Parent 960 0 R/Resources<>/Font<>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI]>>/Rotate 0/StructParents 52/Tabs/S/Type/Page>> endobj 30 0 obj <>stream x=ko?u}i{6·(dYv&R-%'r%gQvN.w9=zL|/.&Y_7v:}⻗?V%kۺ >i%/nٿ1Y=vWlgL,'l҈4]Wjjfrs/eOʂFmwO~/YS|?U-N&?'o{@`;,(% *q Ttt&ʓ9|V'+}G,ɥWߩw3˓6Qwڝ,n.Ndf >@%ˊ#Ϋ{8Nok >nsz7 SC,.Ea@M4W.֛}Z7_Z!(d3)Y~3tE=>sE|'Pz&œ&dp1YI]i*ŮX@XU{r>n'5\_苇,Ez_ݔWF1O]{+-3wSAs7Z}Ww~ro5 "t3B< ||6/rDV!"Z$mY^' rS ,Dgg'T:'i{ГYnttZj0/v%֨MnZt33G.m 4ך nz]Q50T7#/X)H1qZFwϑ{n]#7?N"O ĻD1u>H`Չ(SS[KT}ŴpT} %jիQ_v"f2qh_ G:'Yc[j6QuP Bi$<)`m` zQ_nl,(AsշVnGU6s-a􅭷hW&ruhtO'\چȫ ) T){!XYrѫ0VG3LH57CT6Ov+F]:)H|1ަqpӲ"ۄbò|U"kj.3[*Jo)X$.awN:U_m<&\0lڃ1'<,7n̸2ohrV@uhGP;XL%6wtόܙ2aQgG+a :?MSMgUCtwN*T23|EkF0uU~cQ!7ZTֈka߸LE`p|(Q1\N\g|0E=䉭NXQ!&o: qkuD\+F.["j0LXC-ꌓ_?S/܄HƐ\xZaa!|7w 9V,d ׷8@\+;!ޛluU:PaqĆۯFeWBCƬG%Z#Ήt\㊩+ @t5{!^=/c7y7짽_cKɍ'Q7Bc'{{9 )KO~Dևfbo¤™"'^*B%̡'U,D*qn"LljE_`wt1 5Z)7>?ط߈Bh#d;t#znj͹zƧulFsq@u,_ muWpw^՟EϊlFi|ν\Eۇj1vYʢyG#y]{O"5Hf~ tOʦhF]^2\,b= J^IﴎUF.%1Rdȸl&(DURu`],|FOVxY}5:vn[AElhH\dŠ욢LBAbha=귥vK~_u~DʻOf^F6 BG5bK!q kCCҟs. ''<=qSU:I4ޞQ`?tV2&52=6NPbpD]WCL/<-޹:pNH*phe_r͗3Py^y }hTgt`I(D,i&|4J'z;hu+Zdg`)]g>z.7ZrXdbp? k]jrTg:[ۧY#c¦F7jyn^Ⱦz"+ιRƩ؂VaT+?:v'/a8gLfA & plPo%Chz!2\2:Imp׿!%PЫ?TH]Mx?P\qѴdzO`H?T' R#p?5sDZzH~lhHa?x1)dB{lE 52Dc&#:w8C4*F+DzBs֠TEp2t4(ccԼNҲ5: %eظtAgO,f (-xyf_z"ņաijSPw(8$+T0پP֕(r>g+|wUVb˓r<%} ׅ{Vx}IN _gr;#-K`>x "'|!$&Qߢ.pt1xhH<*^ոW-}fXvHI!H(D@kwo~|l+_j$!d>UPXC=ppŴ/uj s7 @5|s0^aoDDVvsLw|yt"Ǘ0c'"mg tb%gT*wc5:@a@MH/>d?F,'V~dE*3?&owK`ݰ *ڵ 2CM ![>FB*! mScE-a!>?љ&oy!awC n\?0(wL5B]@\Eq9#pg,/02GByP 4lO tg"w'fEbt.T\T`f(H$'%3w-Vyф5nm.vM;ґ;n2t߱co`ɲK(Tso Օ5ڗHm5Um# ++ex uΒI@ZC;m=2ଛ8&׍_Cz;9 xD;'tˀ,t.qG]BBm $IR\-܈򀌓{P/qxWVlP=`g MMIzxŪ7 o r{<,dg W(8hdx WQkSmh T&=W(Ԙe?Nl;j+Fq䷶HPƸ@erKB}XGFWW!+opĥ]P886z_-:Ly$U$#Elk^}¼ -uzCvX^м'&M8j4G ҽ1M!RKsA=Q) 3|>q){ y쑬}h-|N9'kǍ'&D4$ p5% l3{ͽޜ.1X1芻VC~6*8JYO" d٠aa^|0,Z JY]{'_9lp<ȇcŕs!,R4}a2@jD)">Oxu^eQ7|vD<Ӗb.rbFrTwGL޸Ha8΂0L(X:]7.Z7;ijydL~Bt@E8R{_?ɴ%*}Q+Nӽ]3d 6z7-QO1ᵙ.XKc ia?D??(N~r_K %ج~Xp)LЙm@4-}(\CEkeX Oc ,i ~$JvfzJ#(&%ҟ_N>97qs(r0~z^BVA_WW,iz 5n7hkty{aC̛Ut@iMTAjML: .Ijs//^ψ`l!25!xY$Yk`!dr ]+Mk '^~ɉ˲`<5V~'X7fZùu+_rs~ )\~c~K|v?UR+j2!WWCOf杦/$׬`n|4_Xx6=Np;o-͠RImH"ȕ|USv7>˸Zng!iVB1㢢S}5J4MUuzussHQ-̕UUs(Lv1V-~kԲMQUOaF77ZY4Y6+O?LVQD7Z'hޫ^+e)Cfֶ͖pЍ5sО T+ ޷><4t/9u]O7mk_qeMo4ֹSz~?eb91 MS؊nߍylNcI^g>{K+%Uj bfh&n7VԘ 1U/0Pͱ ^{ȩ~l㇙q%2gO6GA\лdvfTdy s.s*\{bZorU3v_ȣvt9Wkwİ.$-P2=cD{='HɴKBsvui%bv1ܽV?eQ><)0%GX.;ؒSJ+%z;_)"<ɨEn6`dS#Qh/?iKu%1l 哦@vIH"zł-%z/*chIiv`t&~&^J5z 12dX#krD(i  &oK50 L|n{?;a rAE:{̬0=՘>s>aЩU-{o4eϨ-pytk/"jPa{yɋxX7s΁dUJЏDۘgzE4ѯ0 %hGe.e]|]X 2Iu@`MPDz,IW߬i}&Y!ȼL/m9.igbiButV>Tu١ f?  jfHQFn!$dJ~z+:s9_lMBuSBz`J] endstream endobj 31 0 obj <>stream x `ovvgdg9`l r bM G[Z5^muj-XZm-bժ2{ `C };罙y @"º9GNnG/=eʎ^¢7Ω3gQBEa@*Sk `@׵iXg̩HV:g6M[f_nyI&ؿheת%?ض f̢3(S.ؾvU'n wbUzܟ|3>o@ =\ɞB Uo.[ҵl݆r m&XZo0^l嚵g>m/}ND7Jx6oP裏 `iJ|O_Dҧ qH[idӗ9*D~bZ@˘u 8`m*`>i+`Fs!-Wk vIX*8ZA0kM 0&CJ#{!UDd*nG .YaZxs 4V68AjB\M*pUeގǸ8ijCa؂^(Ӎ1>. `b̿q;1܃t=ҥ{+Pǒ>6 \O6qaLp5ʯj-.sBO0|:TQj3|+}g[m/ۈڏp7p8p8p8N3Rչ90{\{q}q}(=WÙ#8bKB㇋wtv9X ܻ}pch7̇cpQ#ok'ñݹDt4t)Vi%IW Zݕ:I+a kg$tV,,V.ytk?BuRqUwH݁p8a "[G =NB9`A ipB\,aۦc zЫ F0j3,V6 Q.pzA15> QCL ~B C1D ¨QPP !ZGP Q(Dt4(20ZCRJ(C VAXT߇qLa j $Pk u<:zSP:DA pLfnh n-L$L 0Hw(hDm&iЂz4LAtLE HtІ:·շ3P;`&,ԅ085WP?WQ ;P??g3 MWM0^lzt?M/A-cZ,P6rf̦WMZcPM`X6u2Sj;MM̦f6}7300]̦b6}默Mlo1o1;MlNfw2̦d6}bOb6$fOf6}+315¦0~>6/oc6}ۘMl6fӷ1mM䐱0WlztnӹMMMlvfӷ3=c$O2$OȦ?lc̦?lc̦?lcYO,zh4tSfM]I%ɠ׀3 $L4k5t(b&/%}jpE)\wPhIސ^Eɠp2*ItŹ}Ftng`"NE %kmdkל/l5O# ,ހn UބNj/z:% t$i$>٧fQ働p84)&`M0s;A7H7ϡkI%lI/$>VO?f@KiFǧA'(z#4hA UH}}ڧ4u K#Mړ}Bf̧|z>}>>vܧd4ӤV?AkniFd4M"h7R{aE: ki0;ΗJ&V?4Zpr݁a}4z$ood29L:YHgp5z߳M#LN]Fv"d4wA0Oc2э1E010Iݎ&{D+>![>M&VTp81&ܧIcХ12Nd6<ΠNY4f >pe`FǧѦlVʧ̧,̧0?)F`اrTt|q8sp0 LR!#ˢ3YiLd0iY 8Rrp ~9BFa5pzԧaM[`ij1۬ZdbXT:7&QkuFhOClʠ [U|q8sdm|(sHcF]0&{Zd5p'iqVgbhGl{_՗4249ZV1M V&[eՍNj/lظiEɤ5392S3olp8|Jp&YO\0&{ɲ_[e3t>zlXp.gz2ي1gy#fs}I|;|!wPK`ɲ.ۜv);1*G"Y,\X?%,̸?0 ʤWrxp8N k;0Li,63[B8ݳ;!AvZpGs`,V r6XMvl1f8 -rO0PAE/=%q76^s9.vIy\nc;P6fy`۬N5c2(1nws8s!Ä4ilF:iÕlR\F(l6n::Y\v!͍۬Gtn}>;$[ + 4fD?ft tN-SN/r2d&zY&hEM/<3A͐Jg|8jau !l6\iHNO`|L$vtc dᔝs^YoC۲8d1ko0fQrN&(E>T{Rw[invzp;^ۏ1p+nT!;Raw8L{9 ]vdP&rFp=0>MnwCl!W3t>fp8]҃S#n:eYހe.9!R> 7>y\y\N+/t}d[}Y{kO3sGlB/72>[B@$!o4?` BB tm9BIzp{S p8\w`Q^<^B|Wcr(@6>sޠx#8qӹ}ĊS@X>{NnWG髛eN6  iZ8C őp! \Fe@q5c=k x Gg,;Ng}2\VS~XI$X$|#n:ka}#M,E5;eP hZII,V-PTK1%% ESYQ,gy7:_ Hq:7p8sQ v+a%_E0++m.+gS8,J$Z{tb8E8NFtn5qIgDv Mh8>{P4^V^^YY>zlʋj+ǖ72 EE6(ЊgQp\Ax7p8s1*&(PXXTX-c*1=/[;ρn+*5t ѥE]4|#nZbxO^K_~OI~77ѴD:vC"6.Q1H&PXq,PlH+ݱhˠ 7Tϟ;8's݁aŸM5*6*Vaz|m{mhL] 1BN{<+w@i:>f7۲8SsrÜwDPIjjk&{&\?f2Ơff *#8V żX},3(M0 nO5r8s1&&4q,^/cN*0T?ibp8v}8 1UXu *JꫪՉx,o)߈!ހ}S#jB_̞OT nA5M0qBmkc&TMklЊ1>QU Tḏ@U)/B2(ܙ!og~8pZÄ?*SB:e)-'D[ /uU׏UUUGVUUޖ) 蒥6|3FBN= AѴ֦ [CT;uztASg*6Q[@3V$B#SA$+C#ٸp8GÄ!(MmqڱP[&{jvz[qZHkpWԎP<+Z'N.UzTsdДLAME}uG&aGz$~F]^>6apK~ᖍ;A}޺H;.wwqu7]Nw+n`hIm ume-acZ߰1QƤEؼ,l>ԆZ$\U7lt祪\`¶UX%c혡! NA:2=$Lmܝu[Ŵ$3ʔ'pypIv68@m& e!L61 _OL 5cq)J.moZFb5gv}C?=X>~2/6-<@`Hj\ži_`mEq ?-' I_p@ï? 0|TÛ}p 7gc^ 4‹҂؂p;ZXleZl `fsMErV5An YseF6n6KJKx`1$"$#LzzqROS!J=ERO;ު7z^~uGC)t2D" U:6(H:5mBۜFҖ|p$1'OhFtAF__Rg'kJےc{ S…h?M:?HϿ4HvtIISδWm3܌W} atF{hF}yɫ'oH&h@hK^9GYؾIhiL~N75eΖ4]Sцa'-w'`930IgX9EY9vr\ԣW. |V.߻cr[-ͽ2[RJֳ"0YY0X){YKL8UƢ ЖJ3bIciir:Vfꡱ<#Ȯ?xJp` )&JzR3'u$JK"6c%U>|2Kt&sD$ܒΒ1َm5kNGײy4k-Ӗ_/ԂLH3ZSqL`4!]ƦedF`:JWcW}LigYJAl b1KW\ߤ=whޞSׄc{OzMq?lK ^L_N r7Fp#_\^XJQ;lbAG7B8~h`wgwr 4lؤy#0AӮVA -<*L~ 5NاdI}"s32X KӅ iW I0=U8%F$$oh|O}'<l G1G \*Q+zԻy@#w  zKfGh5ckCgI)!dYN' 0^AHՌ¥Z^seͫVqIԵuVOxN0 >^-6\W맸\ ?^?#b% r'K =^8yJ8NnD5 hgŧ=jUԇշl-vX-W.H^ox E&夂TdY@N$kș5.\ 4ŚVQS5k5gj܎sf(2;]['Z2iо[_fIKssM-}#a! _+&Kn&W'k~BԶEB$G  r5؄Hx3O%ZFo?#kħD:$oٕd"Npm8;kuP,8r$6Oؗ7Ue-yy///4K%mB[Z>v(e',@A""PP"( nB38T I群| yei9=s 'D ע9')݀ ( "•T >s8|w5j.mZSa{^-=D"ˤ\l~G{8^HKTwAE[(Bd!,"3 _ZdtZQ39B75:z' xs|`ߟgI+^7tEr#x;\껯g7 Sﮛx[Ra2ZL<3_Cƛy,Ab Cx9Yet3qXI22 u1-_˴o4svj Kۚnq=ʪr=ؚW^3pW/xbX7b 0mp֑?UoB áȚ/TJk]@ng;fL \{m4d=ݜ󄐤P4 q|8t(vfiçtJyZ?yM;k0DmSD44Qޗu`Qe%9XAK={*y6Ξud+~3s~cͪ]oʑk߰a~q}0gm.כ%hagj`)3Npfұc~x;-a6n?;.ߔx-} `d0YpއWneusJBJZ~e73Rh%b2EDbQ%u7圔ro6A ĆB- k|H|,b-1!s "& jYi¦$~㒄ϛ%11(nLe+ħ*OwS&@ +˂ʨm= jiͦ'aMsV1H%#H.bR&3L=UH{n9q:rA+S-ދw7z@a ѫ{nPVD5RTs"OAhg[cs;]1T5jvvaUZْx8\Zd"67Il1N@aCSRm,Ò LY5h'rĥ#"Fh\ؘ$nүy{_?jОS[o}u:~^dfȢOnl2bLޕkO?o0. +;P ^>v(*ObM[JKg`4 -yEE%ȶ TD0=svyVxIfߘLlcq{.jk6&qk9pvFYQed$X,#PevVG~w#kZeun_<{i:ou>2R_.rgyu(h=xqzEjpP&*HZjx!l9XjC/2p0RƘWݣ{"FU%{G&pé(ݓߎOv.}(*kP rS>@yz`^`QsWb<[^ ‰|]崋7MZrec[2W9aO(TDt&ЖµfefHϷ}x[5Ƭ|1CiU'zڳD̅V~t%+Hzh,s՚~XRy;oX-aԝu3U}GZ֧wrӶynK> a;b |3B\!u?3$_'Sn;ש@XJet;\$5$b]8O-h kR%MP,_?^ɬ-aS= cWbr|Kdx "~vM@I% &UQDd%M٦`(*D %EP@RM ^2Ex!(ȤxGݺ5*>0C; >Ay SS#2_,;b`F0:Xq9H07#Ĕ$[uZ̟2O?\- RnndEe=Guɑڿ 5IO7{>TO!Hy6),PsT55]R#e 'XLF#4R#2ח\\w[نG{O_~ [bQ揘mc6OX^POҡk;͒VYsG??rЎ&`bU eOnN/)tjTj>Wobڛw+'&ڤKTbE@[1Y6#< l*3j-#<MsTF8â`3Hë;?J>{/qBvmd.'nL?ێ9o_8a k? u0L2vvw>&!KqiX㰦e G0"1+2KL$u[;# 00Pdd,FZAi9[@A@ FpQh,yjܽ/~xhو!GLZ>mt? z˾zvڣ]iWB>N}⤘&x-@12o8E$);QI"P{$,$x諄 deQu !#l/eV# #(b9PO`-PId\E/>:^LΡD#ӽvQ%^!.DiN~86s$ԥ;onx^`p{9N1gofkp=@} hZ56fϦł!$qF/bs;5 fvs!QFoFA[2U#hҡ3pk#! B :ƂJs N$@{%͸ԌLQ1W048&#3=z_R 5(edZMML[-"TBfg%kFrL=8(c[[K|ݟquЉ;_=WҟߕzzĴaMxo_k#{ӏ}nW0\EH0qF$fQ΢Y(M^LLd ؇ (AD|JףI+&o0y?c,:;/eF- [#K6PstI6/wHr("ruDX\~6m'ӧOnJIGR; IKY)`c *c-%^tUJfb` 7;y#Eϫ ^xxe:z5&2YXa L;'2V8;=shm2y(K  ovB=, BP29vQޢa2Dd⓸JX^qDY&Z{2\ysM5&f6UXD1%*ĩ*$v>cvqѲZ8`\ ̽Sc Yf8G wfWSO_||3yy4d2z1&*zh8@2~91"MK|}+'BL^zvW*JԆC0:~k0͕|{c6:zmI33~3xF]jr¥ÁwaD R$sQ0^95,~ pQ"bQU٪lr׵V5IPI_m$] .7]&8NOld6e)*^>^D"M&&f3Ę$V!'xTtt%yyIUY+U`zU9ΗoT.-3\D0f)o4(lx_]^MxW>F9X_WvݸLK4gVuRײc->d( ό3B3ƶLtl'!.kQ.9ܞ*H!8j$t".vKg#!ߧODꓗ6;%bgo7>q}g7^hhU|ް.旪Zԕ_T)3l͋f"Ģj44fqdNn2NxhKP$Pp5aD8,D( bI _ӄa TIQ~D]\)*kb$qDg #+z 3e5}~6a+Ko>[Jp Y6v0b\ ؃ZجT`DgP?y2lo.e9^I~5ez5~(ËxktʅO;GA1uŤڪHL&K K%Q ZE0>vH#'P8"J]]-D`߫sQˬX qTVA6è"DL-0<@2 /Te$l{qg~u|{77Hg;L~ /;U9t}{?\V +^{۱ıΩT͕ 6՚EM!V?_\%Bp0MX ʧEtʆK|>uSvvIm"1lXlI*BLʡرcv]6]x9fޛ^oޤFR{FJ Ky}EwsBq?ӿU2a~2.AeN]Ŷ"m_#_"&5Aqk8)q8x_qQ$ۊhWR-:hQWQ rgDGutWpA)A9֠^̥Vg-:Ԙ(`B5W+,gP#Yp1m,UusίoHnXgK.znߖ׏߿dݍ&Mүaы-sR1_1%#u<O:xr5T+}s'=1geW+o_ ۶04u3-呫GS9?p_|u[l% lEYa&_bRUzET9ba-! J+n"t&{VP5uc3M=%܄j_`'$)o%`6W8[`XE8=@J> @RBƹԹ8:xYV]jNQ1JtfW ٍ;;Ŋnox=y`{[{ݔlm9?$;Gns&&~)/lKbxg_zT|ߺt[y.ӭ0 {c< G| -E|*yá5`i J3'9:{AE&bp"")"z?'ǛS2"YUEEC͠`0()P* =fO0GMAˢzL&ݝ+kaOmF4ƃH $} H#x66@jckgߧ޶tlϥ? Y:|c w(CZX õKAzUnj7C5%nHp'Ni\0{o˯l0 n]w_ 0jYt\Xs,16Pe::V$sUJ QV^챜EI٢ܬ \El8XcYddq<Rf;V5pLT!dbPեN\2~.F!Q (BsMD։.OTt"Uu%L$&0t-}Ϗ}^ |шH۲+E =xtRGl6y$sFpn<;uф8y1=P?F+}:ڭrdz1}`S2;ltzcoG}-6($A1YJG[N6 ADH NJI S-YɐSeMiL7Y`VM˺80;y e{8` ѹt(^}YrmqXbBv4ekb?7s"K|EIt0d@J<7**};>8A xSavH"֘jjs,."sZ2lA;16V~JqE5*[\PZD"aUP$Byau αgH>e d˚5DM5DɚGyEȲ X [ӨE,ٵM( qut "B.sEi !!Qq0 :b Ye)l `(  |VK*H"o}Q=ע+Tc 3_WхJ4;5[=t3M`k79ݭisV63Vaǰ5o]629A[.-նxvKx2$XիeJML r,BƇqw(ba:Jṽ:]=+d[;Be 2WfN4rpO;i=O<~|ӔwNZ2~#xO|_ ק?c5`osfl;Tk * JrHݪ3XT8bki{2sk8os ^Ue$ZU3Ddxm::ߺY8PD ø]ڋdlp6l4VO9/ZŢr|J͒ׯ_r }zw{9uM3֬onyUo+ KWYԅ[},=}(;" ͬ2YEy}CDD}h!"osc5kxOWs9.MPٹpH= (saSa47l= dլ gR} f#Wזhl̵VX):| @ynk $4yy(B c4Mv̍l%j4no<\!-X:)fG :PHW͖!턱~kcq0NԦ m2r@8yjwwmyTr_]7 *O6[1e0<r5*M.J\kNZ xhlʲ 8y/X20|«߭!a֓iv8x[x2/oGɛeUԳ($U}%y`M17&@@y(BDmMy9?òS1Qx{iN/! hœN'IU*.e֮eG(:LHC[$osu>rJ'>Sʳ>t{O=n|F{,ۻd=K,{>쁅u[/p)Ntײ!CCtM!.()kG0LjxG隨n [[쫺W-,MHK(JؔaJc4HC#BQCƘq}#-'[+xmT\$Dp`|BduF,krc`3#%oS渝x만~gJ%< >Hr֟7QDЮwx?՝Y?rΉyV,^/ϙ`Gc#;I`HޢnP_Q4O|(CIf*Oy?Y40(i(;m,6hCӼB 4 \ h$΍uS28ˍJm:5 R>X[%9#ԣD N_"٣"ǾA> ĝ H[u' #F]WGa&=z8n}ňQz1 }~x)?=S+Yo):e]晎I88#Qߌ<`4y#`g, Jƍ@,C:ZϱDZF- ͪ~? *b + e$Q)р'ظߤLD{@, 08)?i鄅cj6Ħ5Gᓯ#h}g\\|'"S1?S2m'1 &f^f3Q (7@~v`mW B-wuˈqCCi81ЏҀ:2eD 10Ga@PXQh #owbl$ +0  e /D?_c >.??f?r2[gjM35Y6(F B $UOf~W^xV&I!AMNl6q,b̼YM!l-QL݌G H 6߁xcGmhX0?-:.BLUlbrӔB;/os² "T-[=zĵS9۶Mi۶MsKO=&Lxaq":E3Qڞ^ỏ9D](s^>Rr >WrQ5&|ԥ[gyrt?(dY+EZUJFS: !dk-Dbp愡Y' Ux[6bMr3< {۠qU$OZ">jSPc DBjW"RmpwKkCic0=l5C6%6 \lL3/XwXx6ZX&=MrSӥiFϊYvWzI69f/PBsz'r+9[;oy;MVlbtpK d-=s ܗ=.99ui˧j/{ޙ/fmO߭?&x}REєi_1-y{]Bȧdo`EkYIσT&Y#䬌3"n2aV@2#ޔgdm/h7E~+(1q*Mm[/(>`0|'bp黭pĬHoՠ {` Ų诇v{_6>\dʩfOyn٭yoAȲ6X Y3RSGu{y5ڍަ<VzwBdFafO!Yn@15n%{VBF֛VbAW@JwAaŸs=|)!n65]$ܞ2 EpC?Ӭc 3#ESR1ilR : ~K6xM*=-*ЬT~8~㓾'Nj1~'Mᩚ1_lt<H;TАWhAOebi(gۧ@6.cKy^^hd6&ݕ8ی=q~ip#S- ~ac?_ QG')6q0$VYX4vdZ&v'Q;+j8iu2glWݩcDN 9愢sչI;ߓ)"o 20_0T!NPFM$D;K%~6+ .MxCXViBE]0.)Kdm>:f|Y=w4>-T3b콍؀(ݺ0L2Qbh0v ߇ g It@l9PX*hfuC# m H{ p!$PkSi"TIuU&ZZ cɰ|83G&u=]q῟3>@εfv}mͮϥ?LQi0#,bf1zS]%咉 j˺&Kj&d6S$6lh.м3 YvY-У=(zP3tf8ڥvhugbx#X7og ưR85`#@4.w)H( e]l iűě~*k~*(2yM_[/w_/''0.M7C"YEׂf`o>U(ay;bvX#Qd0z=yk:Bڬ8B\3FЦ'om@,"}VtJ+b "L1%OrYd :-^SAwDlP dH'go}7;§m4e".}1}}>`" [装/U9sjG(wޥx-y`#f-72ś8`YD\ȕɵqs?\0x{9[#Nxeg?3m}_&?}>BDJwGs(T/쑧T4l\6WRUoX44 PGŪ%:--5.Z56Rټk6t =pV Vhl5V `-\0uY:pHX9#RmoGıs~勭)mfpf_osYI$R. fd ^ rL tc%2axNGK?x_4ۀPy_/) o$/@~HI_* UvX j ЃtPdt;ykmCAXS@hM ]#Kq(qȗeD2.97$>*q_WW.w ѐpKruSz$s9 \`w)>pX`B` X,짇]L]$8CWʪ/^*.^aG(F q {iiT`Xu!;V (j:pJ>bV[!C̀ P YRAO&FJ'J\+S1aZ_Y(++Eݧ>\fj&w4jʴ3)4qK=|RϭlX5TnR| 7!٠Y7a]ċwBcqzfU90WMҤ&0Bʨ:x̟z8'^+ƑYgxTDu,h?yal5uZ:ƴ9=Q%Ny6|eV1&b X`X@"i@fXC+e2 ـUMQ'辘rn(յ<|g(@xLg n82W0fkU G $,ch !Š(0$-AɢM3/Y6voܲjݵՋZ{ǔDtI[8jۙuPM Z+uuEU}Snj\ftguNԜ0 vH(_,b e^gqՑ +UVې?GjUuR ec?6贈UԺgVɪ*]M퇓-.>4ww7k=fև>{0 _xocyBIjsO`O&.S! 1 Q[T.-I=qbҥ 9e"r@ (RhRsP0cfXâs=--(zY'=0T`Ca1qRRJbBXgH͙(G=}sre{5 mS H=x{ pE׆pèAwE3 &,͙84\[Sݺ,ɹ 9`=lA3.T>eW 4&E҆fA 07'>#\mpи)H!X,zE"ٛ.ưFr ,aG/&ݪJO?z!f|+5G͛}4oWwb_eft~zƲGft-IVI .em.tlw&f3| P0@>]^HP#6o$ l*(AI*Ll` *$\$4zorؔBki~)FS/2<L۪{d-8r}+i5s&VZ8Q9[7s )^Tͅԥ;0ajYR6eFYe U|cX*D҈FY/Vԉ[;z`~#Cs[n/$K.C;6$J_H$۱z$BA^p2MOϊ̲3 u/32ZߞmL_t1PrP:ꆮm(Mv$56 Ma ^pw4_U߯\TjcEkc1-Q1P$+V %Z=CP)g8DoihͲ:_mlm˫蝘-uCԺ=v Ox~~I +G %:V"Qɦj#]j(GY֨Ԅ2T|L:)ɸ <ъ'xhO7]A5s_<~z|~|a}]9] -TVSʊ`e47rAnFo0dktF [xE)]MKԅx\g_%e7PaH3[ޅv%`PB6! mC[[u))[i9<ux&;[]MCU`i}]J57:zo8/zDj]Q\^\"om".l8cme˳+{&[4N{SIRSE<-5'd,gw֕ih-I4ZYw\x! ;p |dK\ʇ3:7`ܾsvS}_==%_ jNM2OT*ȳn(_[Y|iԩsj[sj }nh+ȧ,ڟE[ >.^B&t@hjTUW(d :RhL*feW:sL*=?xǂU-eE U*?A|Ǿy]<׎~}de1mNU_`-иcKG{PuGϞظg\Uig% s2u4I%Z6'd vV:”FAN!R$4|D41Fܯ1uf`0Q'W-e9N0m<}uÃs??ܷ#iǪ]N}Oly#;vO#P IϾ15[[x[(k@fSKLZi wşTtgv.ɚY'*}lzV+yNWy(1Ja?E"D f*5@QuF l()j2fħb܏nUѠyp贚h΃Zݤc:[cjhnNNFV۔l# 9\bV,DD=nٗW.hFv.{a9ZHSE c\Sf=kc6>b{fzN|rbеcHhae ,(r ih B5g}: 3ZtQ'juЉFB􂞕 ߌP4bP\:Qu: 'IwB-('I'/a.Qvrvb6K{VzS]qt'kTHXMBԔx)LL!4Z/A-;0RCz^8@4NBkvꄵl"G$3mQh<@BĀW jb [d"D $Z$ݱ!>9Jo9*n:ut䰸 J+D Njv MㅗshL)g˜8J ,#2MGku:aHKZBTTI?/ı[,})9txpp\-]vAeXowz/2vvу̽_{1-;t_éݛ/|ȳn{}珌l/9ʝA-%^ÜTc ~Y8 l3/dgJs*pT0<㷞kfCW~{8~.Nqž[K8hh[+{NAjZ)2zyݗIt s$SЩdz^&ҼتؖX1Vgk4nzyfL&y2쩠Wв5bE-BBSV-3̩fjNU!˔8> *k 3}ǃKj"tHY&.0㳒;Nx ]ZaӜvvPu{pPS}Og&z*Tٹbs}nrsN\u렽y=_skJr:wР+!Wݠ{u!$u[Dq׻$3sG@ lB)=e, Se⫷3u1;0f&n(mK]bbqq18s(FP>)_fQ '2NIcT bc;zwwksN~Fk1>9n].^]Œ^+5 X8 jR$!~Yv!6ž|f:lRm$!V""+>蚈βvǏ$.AzoN\!DANvg23ybQ?R? Αh*-{)7͚&k_d/S`הbkz=z . 4UΏhသw7:;.%]+sb $@C/T;*K{"ŭ%REyyj=&0~q3PB'g߼:;eȚ`s#Rӗj辟@E)$0щc+jcN/m^5uqg[ 6&l~AO.lCl棈F H\D5mҿhiFۦ-(-(`6lɂ$ȣtZbE)$(v]օAP~Z0ůR;$m'ϿLJ>!cn3s}{0܇ȶH`a2t4 5[JGD$cDfBsP% 59NT 񇳷{FYXWI[As&5swdg yvo=^#i Y I O  VU2kpx3{B񺹅?38vL%01 { 3S}jM\Z4 VΕ5k\bIJM~yXsYaiv%$$癷zTSUE>MtH 4P*=*U~z.XO>h |V+Ǡm&QG `u ;A8"|ueuy~>ߡ#fBCt| 4г @ ԱAZϠ=z- ' 9.J+[x^V-lE)b] bEkuڽP:<'t+Cm־K߅@AT%L,ƺR'A?3s1!jQp1)~ `aKF >a^<"#UOAP FE=i*_EŪbCqVre_/*MoʛʯX[q2NXVXXnZ^Ѹb꼪BxX}&pluuo[soZ@誧VU]՚ɫ OzWW{V_@@];^&]D$9 q~JrH5µ hJ6" '>8ڔaIb(C eoZ b^ڿq-uCjI<вWJhSM6;jbC[ Mo08 V A܌mw` ~7`̸ ,:f0fԣ4Čzlzh6{1xq?؏#nD7A|lF^CEv+NH;r"κs"~y"Z" rX"KW8IEA<R.qXK.Wq#NCE q':)")LRsX"IeVj(Rģ!K_氖X9lnTa8,[Va3f fI W8?@X3 ~21ÊX+W`E _+pʐ9_+!Ƙq1º0uayCy;8,rM(짢b_0/~D,Y/6&$ެ0kX.s͊Ssa־ጰq35! 3<[A<9Bo0+s ί&L0k҄>:}tؼD{D&T-I#NH;Of$4A 0PPH& eO|sB;!v`K6 ALCI7bwøq: <2NxIǑԗI^0WMH0LB[Ƶ8 0ۮ)|LLB~jX%ɣ9q)F~YnpOC_/LA+JN|ML:.FٮNl$aL&i2(Vr0Mg0.)4bKviGd4oCF&Yز.bTC GFv!? #@\WLSBK"w7o׆?8]BԌ0 m 6#\q]X3%L>$/ָpBɬv502\* ~(cW T?8֬̃Ťhr"}l7ߌL"Jav=lV~c|.?h `>Kg3 y3qqr4iWΙd69uᚚX eL T #tVن~zQ3qtVDŏlW -*g*e{xpMrKĨ fkݗb|fB+ťE5s7/1y H9R83v\Nh WBZvg˰؆vˉj2&Qh+8,|/(5?W}9}9#PS@k3'iVݟ _>AoE |Qe7w3~F=2Q<XѫInP;)v a.#sÁ%S e82z 3>]&#z;s:_ ZٺXfRSi8BЪ y{p`!n)3l!P=8 e-Q氌ϸWDԥ^^2DtH(< da80fc2-|KbAEXq;`9ZLH>OQMC[>~V 6bn-mXelj5Ci3C^^3PGAhZy;w.J6V֋-mJ; vGCh񺠗rZh>Q T:!gmp#>F? -Fp6Ec@^yVBZ^ŊK9J;&^!U#ʠ ɯ o>г9EY qTräd p'egX-Rv>JᯑM(n)ф>+VksiC>5ъޠ*S;e<6Z5` >].L(FWopa.\Y^Q-9N㟙tMk9;R`hsyrtg19&ÞmP3ۦ>6Rߘ'Ox嵮 װ}B#B *1,ir0 PqOBeVÚ/VQ&O&04ĵ%PQl.vOxHQ; )$(dmƜلBϘk4 LF<T.j k@Y20i;[ثذn}`FhA \]׷Zr 8G7"~]V 1#Є{!Zuoy O JkanYj>焕{7^/.@W|H|T|0ūWW;W9+x*Uū +,^_x5<Ÿֶ3 Iv= L' Gw"IiR 5J5Rpbb!Ec?.>ۄJHQzW-SMAKuTU=zgTCk!T."X}5|DPMfoѸ_h~ 𯴔PUQXm,q81]~@{GWZk_iI\f@ (+\s~KUW| U]௫@[T!Wu?׌C|\#U= c?zPς 8pjxHG4#ȣ4KZ ya%Q(([Gvg4< i^6bsy hJ(Q- P#vUb=9DvőI0b|9nr 7b| w\.` ۶ofc\q3 =h?B=RV ʉV_i &P%_w8?4Uۈ!ayy"hx8%ЩdЛ<%<-n>*jr!9Hq9LGYyG~C~{RIiO/M<5g{9<ӗn^~7wJz➋y=kuX%لg(/&Mr79JNg56%OT:@h-먍c韔;x%$O?S9ަGx}^Ij)9%=%pO{>qYy*q)>Jx%ODjEj0YzSZSJ\OY%r̥|O9u=}==9zaO{s.go~l3o3J"4u5O9/F%}xř+WZ}Wo+`} {j?vE <lx=O5p5PU]׺{s8G{}%V5J5B !KZ%^bxZk,kZj 0Iz)?TРcXk57Ƽ\kךkڄJd bM=!vīMfeLeFq,e137VYwF>bj|tQ3-ff?yf2Fݑcf\0#ig]3tOŚ>>mΛ3<23Qq]FIz]nFq63II1ySG.L?0h9.2fМ5++)6ŨjƨfMGGۏn{x+NjW?s>1Edb^n O.ڬذr!iefh֗ڒlf]y(Z^դ[ A.,uE-լWA^#'ig'\viC,YfXgXgY["#2#mRTGD~0z" ?멬}F^JRvŬs36;.6-6Ovmcg؍qqq'ǯ3l!U Z\qBz츄ʄ Ģk?O&^&yU&UV;]bmVu]#ϱƱNIO/;wܒ{uop7Mt Iy_wo2r@xɁش@y?{`^p[l(%84j[?}Oh7tS,A;A[gACH%%Q9&irꤝI3PRgaaW]U&%L>nX`xYaeq5 +L)J.KYwWe-kA; [ENQ߅=X~+p/FR쯄א =Z8qݢ_ wc%#qNl_/[ţ ]xFPxMw&0EHŢbƱ!,9+Xo2ݍUxKe`5*eiXc~`o`~eo0ebٷ$eSwTc|ƞd)VȞfE6=fb6fϱ9l.[VΖR'KC4L[G4V4^ = =(}纇liT =%-J2i)y+*^I?K+/q"J[_K~kNuwsoHoI=;~KRtP:$J#Qt\:)uJKzO:+H E+c1Xb11Ș)&&&6&.&>fHLBLbĨ1-ud~SKz]0\/^C꿇ng`HU+~ m᷶4륱b i|]|`EJ*Z{sz~!tɐtKddlDo- 1X4->~K@C,huQ=4F( eA%^n]7w7.I_w@~ _ %i-޽ X9`=P) 5]9~O[r9~+ ߍo[q|qFIUXDLB%R_|ĻGSL<hB`ـ~ FxigFxigFxi1QwX~|#;~iKX ֨5avXW@ h^+y4аV@ È "6@$ fB4lmа A6h ۠a4lmаCvh ;4ہ@IvЀK!};o퐞]Z?E6o*6#7mWL7;E'`/6fWO#NaEAFG _:Y.[1kt#( _X6*lc^6"{ *KXd7AaU}Ć +jVXAޗЪzЪu -{UUDŽhв-вc* 2 kyR2 ?># `l K8@ ;|"tg:qTYDxˤ k#ڥ-uү =s~]d :U@ T*`#R1Z C &cLFF;sw<3݅ b:?yzO1Zs=eڈBs?ρF|~=ǜ? H;|7FpH2!Ⰷ1?Oxûv#Clh$FXޏ'a_ mA$#.# -P6 < p,w>b|[U.Q@Vؤ]z1-6sŧ9ch;2Cj9q`#{}=VGgH`O,*Ep*X})8n*; V\՗B*pܫ` yEdۣۈwPTPl!gqjx9\74RP߅zj>=Kg ȳgp噗gp9.'rN }\N`a|jvxtp:5<4Vx5J kpt5׎$!] {#1Aԇx>sl'MRwSxw Jg|;n=`h%]\v"Z O/BBVl BVȆ1 pwQwN? gwz...!!AT(1Ӯܞ]:yA Ii$Op o]ܲ/ a )b=a9[o˾eQԏ~yi@1sXqPD}p),r8k5Jc q@;hONϻ;3s݀ "ჂXP&CxA-Bh d(= s!,ڽI/"v7c(3;8wg[<4`&s;jވbVA{^)̑ߠuIVs7V̡&4{O>fHO`D6M.<6f(FYJ/ &?k^=qXa{yΈFe$eL%@&`Wn}_Pt=n΋AV $+ 6s<7| 6"ʈ>]E>!r“[jyϴ&96ioVڷ;|! m6Q[| V6{:8 x<9`>nǐ |p5r|A ǚ3,g; --rV=^dr6s۷ҩɬ~Zs!z.FFr{/u|(𛹓,ee-}` sяϞc1{)+}_Vїr{Z ÕB#'\)kn[F ~kb9Z,u9;}GHzڗ?op䩀</mCrSy!O9)<吧CrSN_1viz]1v;nwE=Ʈbo+]P۳9~/"$MVo|߬S3c18.GwX'p "&;)b'~w)" [ᗤQBV%2 p:N!n#UhYe~ͳ4蛧۰_ m\(@6@Z {Wb.&}g+}hmlyjO85Sëw<5 Ex=^D_ ڏ ދQ{o}uڏ~BV-8nc4hCt(_/N&KvĿ*I'z)ojeVAAWz;|=oNC: ' }XK}} 7gof n0c w8ooy n?»WȻfً@"SޅE7.$yoɺA;'gf=Vg U!Wh€BcWhֈB噇,Hy-bpxo_Mz:j05E[K}VA\t83UX#$<&l^jM W8"<#t BJN\'~+^(2u!llyLX,-vNP˛+05|Gi^k5Κ.>kmewSjk&a{öVi涽)##7#ȑȯDGeE=ĖFD}[ߢbtb嘟+r*` )09D@>0|e X`KeՀ(W&@ `ՂNbt96lppC`^PlX >@r}qe`4`WYMR,WV+kQV)RlSv(;]eQ)Ё^JrQ^7TAw(٪OMRG]xէtj:INS(gB~MSK\uL.VWkb%UTn+-ivT^(FMUWYچHRC5pR٤޴3^R+{=^γreؓ#1H{=˞+OA4>^lco_d_Jɾ޾-kZb7ɾ۾ތY{5y[y].jV^r\yRxSBͣŪjZFZ&&*!k3Q>AgYC~3<=W9.a^d\̦R}}H_"/(+CG١oRJ^Yzޠ7}z3z'el,E`_$.df̈$=_)7*I \YK?:%g#GcnsG -Mh.6p> :lgLQ: gs}3͙);ц9VםFeםxK-g)f59Qs J<ݹVnVQJ*s5m|pptRf88;[)Σ<9<,Dsyyy%(;\6>3KGO<eF]-j+ދ ^=וZX!:42mUd?_*AkkD9Zxt8 9uX&h F:fykk;2 WzSNvuFǏ^OtkW=W=7M^APj6oW&yGxRfqyӵ"xt世Q:ysdcI;ruXG|qTcTEy}ij屧z# }g"yg{xw[]q;ɻ̱ٻ»FLwj vwwnҼ[lW<ݎwxLzo}AZe{3g5x{HnB^ڬnwQ"mv)s'(+Et+[ļW[c(5efWQ*~2?v8;M<˕);b ܑ |̀WO뷺cfG !`tj=Ktp~I(w&QMӡ5+Jx Ya?x,Nќxjyi"{r`R`&᳁O JF7c4aq ;rܻ~ɳ?8]iqOg `eup^>m \+79AsrW|-<T|qk`L'Agap:^?._ Np f8ue ,O.N`{`8V` NFten]GӃ9E`=2XESp:1XeqseҢ-ZՃu>,M}q{nS<5N!Z3Ϗ!- ԩ8فgUJPJ(u)8ƅBДP~04#4+47 T* -7JOhuhm*)T qqC;s4?5/..IȐd-IB -ȡ~:FIz3;8ɚg$;'/|upJ4}n%-t̴HΫC_rcM{E [l/bP~ˏ' b5k-DA7[u*9T@FkTt K^J%!(FtEx*ߠT.r6}WχoZ042CI]'=WPnoJ6q7[gQYGoOw'1;OTDVcSKȞu"Q'EQVp7hę4z'y)C~MGmf'?&@-?/GfQDeRe--)fJxPS];NAQKgu80ņ~?H$CQ(JM?qk QRxH#R1uU -M~oD2A>u 2򿌙E9D:V ׌"__$ wS.uq#+Hjؘ h^Ri/!|y۠؎R)eu٘ܞTvRndX?2V+jE-[¼w{zg[Xp8Mx rKqEoJyLR9d҈b<3s.#3S7477=k6"wȟ3X} L1lKs-؁PlI+cct* m^&epO1Ȟ_"GKYx.iȰ6dg"l$IRjߙ}NWRJHc#Ҕ"HbҔb4bRшH#1FH#r)MRHi\Eۋi(>ۿf53k֬g9V!>UfWCB"N4|ꊺB|͝'y}WW2UKiThEh29fLMBb}_< 8x)b\\ֱs;{'j]H?:p=L6?^k"?V8h}6*BEण[CL^G#jFO^Jwj/ {?\먚RWDk!3u߫,^Av5)OY X-j^d J/uO3XVױF뱞Y7(w44I/=aa V}]q.e)CEwfJ[u'L#.Q<`8?j7E t>3D)N1Jwr71p:V,$ȗ rIҘ,Ey5s /J@~3SvsO pzAfdBލ=BƩ|k`c&gek\n9ݣS!X6^M6]5lG0`(0%ƈ1Q5Ms<@,KD5JZb.![n"1&cwbVFwڃ0_{"/{j14[mz7vU3@CC"p ׅ&:'xŷDxL<.b=.^K=MVx(0b|Eo7PBOm(FR?Y;mlũG7/17F3r<]*<=™pF嵪_7?7lpp^Ѕ>]q~ږ nכmGezq!ˈױs=6q#mpp ‰R-=㡧#ۋ:g߭[<^^^Pd]ZnT~Їhxl< WˈUmUzmzvyɡf]>%=>Ԧ]Z ѾtTN&B>qV%&e ^}>3-09HS ]|_O: upޚu1c//(}'7u|꤄14?yP~>h>LG/a-D?̧IK+*dsm Ŷ c/om@d8Q-|waZ-Aio W LO´|H1 \:c.$l t5"*}*9@b~觑 ? (k?r4MB7-4/>V3H\i Qt% A[!b@w@97 ^qЏi6CZ b;#6ߏro! h V6T+]~ #Kh/ ZA UwP4\i|ڎנA4sf赠Aߑf*h"@#6o zj =P >~h{ z,$?<,@@Z&8QpVoAA,$z#`m*Fh5SyyW!5 6aS}txCۈOzqޮw3N~2чAO/=4(7rs3>j|9||G̓>};RIIO颏+Vsx\h|Yn81E,=bGT,#X!V5b$wWo8%!bβ =d/}ɕ9>ȑr+'L3lY&T =0=I3JJk^4aS9 #OaѫftbfO ]c7@C~ 'r?ؾ B )!Ji;[ c= I}j;.̑7 !.֕Z!zl"GIm)яuP1 /}(B)wYxogo(UWbLiFb(okDkF6SD#݄9Lmkezߵ2GbZނ؟s6k!DOx0pE 5 }wH\G4= ZG5lgh,e]r-lZ!0iZTk52ª$^UeXVb7ҧDY;>:lNXma[ĩCVf['LkRXj%I?vo CRO̰Zevk=eg3)W.Ie(/SgqBқf 2r{v5C ArZ)m=AcI;2ҭ@k2չte yKadm$u'K E>k]m/W%WSήGނ& V Yjkןsr\҈u;ZO?(u>dq }y'  ߮r7:y#`9qaDNNEtwkm'+LMqYcVN=)E^ĖtS$HmLq;#3Y,v:˜*g̪s;T2{O8gʝg ^@MJYsy{s0swN!ۆL\{DIa) (LmXUΤ@>^># FF3!0$L%ٳ3l( *9и dN6婵&;ŤU37PGkIF;-9-3;/h FQ9YA`&pLfQ3۳=-7?8ȶy408 4%Ah'K4ƶ<8tpN.\\\8hEuLsmdLdDqدd{s ;^ȵb􃆵nԃ_9ЯvqCʛhǴf~4YLFO&M1i^PQ.Ҋ Tا? 6g>bJjH UKq^Q4 MnY@NR܇?:`k$?G-(}kC8$:5ϑgB3 ͆ ١2@ LWTj\~-A˯tyI(F7_[gZkJ_g腵^q}y:p }:']urí% Iz뒬k2ܺz}֫ggeyj:$k}C7M".JlamBaJk[?y,pY\//{V}C:ܟ`f#Xvx(Uv}e/WqXƗL @x&y., X(ĝWdW2m^MWߋk%^Iׇֹ},ӹyȫkkS?\O`;AP:OpHC)\<9'L,mCQF"2B ki;Av(aa?_l:D&+OPHPDPL0`̿_S7/_lBolFXO6o+k.T<~Z[/>~mZX+ow" ,Uc!̅Bg^^O.5*7ƞ/vGl"ӣV9{~yݮȮPLy(7G͇!RP0&//162b5 %k8Hc9;@~px !s&8A?~;4wQbtҼ|@tg87"㌃GފXhkg? 4#Q#Q/s4bW~%B+$4;6qsY& ,7:;qbn0,# !aqS┈>#`;_ L$(%F0`<7n&XN`5:z- '88BDp̥e ~Zftw![%%xL3BVUFSֺ̡{AHy7SV{nνS^D:dr 4w60Xk.^p.Cïi_1829G sTA6k߈tsF:s=zZ+bkk@ {`\`ѮH  EX.0 zv!ͅn؟` wa+&܆_&>p>oi#|-3whYJG8{{j. xwq6&|x.;}[Ath~2E& #hԲ-G!2Ld7'eb2 hBjQ , Gԡ?&b1^dZq+Vُh8D]-z|F YIM b/[9inbtd@L)2,"OFeT|AT1T o_70yI#o7CCKyȗʏȏyU'?*?*Fȏɏm6Q(i #bX'*//& rxD>/ u1I(_K$_e(ߐW|U|SYYLn-3^W<&""˿ʿo7 yPxS fw⾥}rpTk7Z[ms:{ם}_tQ"[PP/ iSLx틤λbO~-Ai /m4i0Gu/KyB |J[Oe0_iGQUhTZVK[m6k۴nm֨֎QxB; Czgzo <}>BKz>M"}^/WuzE߮7{!ޤphЪ0Fc3FQEF1^oL2,c1Xh,6ˌa\?/txzO^Xe1.^_aMWN'.i}<}AMq<^SFiA3fv6]f/k4!0s9 ds9ÜmfEvq#m) >l+͸?oO" 4psv"p&WUOb\b!@CIH ~5ʋ :%9ĮB,$7g0>| Ҽ ByQ`h"f<`+W`UoA=? ?af [ǠT#p{a()Ds+}< ~m nB铑R|߁| P[O|xK׀ >/Onlw |6vy/ztL9=iXѡ%q!}F&=lY ՁpGe",ZU)$(:4thiО='Y~{9 W*O%5yo/lQ~{\fPY|z ^wQNz}ف~A%)Q}#kUi-~jZnʪ~K-p-ukn+\:~$v$]ϷǻXj1>hKꕌҋ۟LO.pG@XRcFDa;K+#ۡ__z{Pc5o:WZK-[ W[ ٲ*([^lUzU-vzњW^&NWOlڭ3}z[.rVґ2 /do,jteqρg+qb1ΊE)lٍb7ܓyU8N샼p54xj1p;oנZtPzn Z*v} I[c rk YW6k=&p[n0,74P'||fR{ c6AQnTFQCPkkfcNch4NMaZfL#H7f7ٛd;9eqSRsQ3 IKji%}Zm#O[fO9GHflre.2O̓KD_IaeYݭl!g 0XV>A((]>A5ޚdM1[ fYsԾcbjefkQsZc6Y[͙Vkk.2js:Jp4˰NífsmA;fv;]l'g'm Xa]`G.X̞`'S7!l.ˬv]iW5v-Aޘ'S^BHmtfwFs}>f 8+˱y 9iN9tiN7{؉vEzI){ idq*pg8i,pF\d68%] wJtड़F)13;s,u8KP,wVv֙#Slqtgf6vL$x(W7AIDz((Ƹwv%V7/mߦw~2N7))|pqoHO nSy)$Ai/_VGJcÿ{ø {ʽ_ w,ĭe-- oL屃R{K*.d98X/MRSwsɡ+Cզn`OЕOo`ܨ<@Me2I@ M n]EԽdR5)[Z+e|*ЃKzN-{ݮ!J-_"I ـGV>l, ^mg 쩤;Ӧڂ+%Xcw in>f|hX%XO 2pki ×FO%g ZVX ^vBW>1pɖQ{,`c+3Tw۴?Cu/f-.N72^s{i 'J'AN|yiV:jgݽ@8%i,ɕ3%];/}zOY[eIR+NkR֭ۡMéɫtn|jE+u[vVm:6MT&:a5'>\^;R^W}.-dsڝ<䰽p瓔Bյg#}-Raް5')w\> b4`57ˮ mT{u+j W^\5[_1>sD+e% !f%oj?iMnK u̽Ou7}۱ .W/AO *!, ½MCYU;O];dz]&v Nk\Zk5l']2u8}n?xu}5db |~ݲY|kw>wFLAA;[[)z~ݎFB]vښ"LmEp}y^k1Q\OХo/f)zv"I'k[ e҆{8⶘~mis aqݵJsق]$\^4иw>t.μnqߵXMt.Z W )ӋzTJJ|^t-HNZu&AO/okXH)Hځ]N%_ǧ:/rwc=\}g־cu8;7(}i9ޅeWnmXN*ϹL&M& I$I&IdVHVg%M&iB&IZI$NbLO~mY22g?羮s>u}1JZ}! ᕘ]C`%E#;B&bZ-s)w'/kK;֦rw1\{qm*w'˺M/dQխ}#7h.%Raf!agI[;>V}!*v93ISM9U9!>VsBNљ1*q(~ɇ3qS3ps%S1*ɟ~y U af|h{CW%CCJ<'d?xɆZk Ky;w{KwwOЫ6Õͻ7DQ|,Str/K [W |!|;/|/*!/T.2ESRE'%l'z?}ipx.,lb#.N S4<ѰTȣ{h1a7b&fy/%H)%6Ia!]slWX*au' 6+ `׮zbs̊^v.V-KYrT`=Yk{yK[(nĿpcNpc9 HacYjPշdƝ_+جŚQڬvY5DӬQ8GBƿf}'VdJ23Ht`{3_'cgƞKi)TxQ9}.#rţb{Jk] -U~yRUn l/}^= \kb/MX8SU)-Hweʺ/Zn} n3UxlgY4W(_嬘m'^B4ƣx93.`#8VOYr':Kģ]?8axЬ#?/ )V19ZIn7%c@qחu&CO|dc('Q8 *|_k=aC0ť.O-pC*c(YQfqRarhX5vZ^2hGȫbvx]p j/N:滼3G =Eiه`ub'd+zN޳vӝG>D(j[bSc'2<9Xš6M@WG#'A:e]+?TnCIWr?gO۳OT o=o~ǐ=WA rw:nlѮZɻvznVPwN־hk{庶8ӺXΧ5A)hӚi~9L7a-r(Da665EzU8C0i|de1u~L/}ߝY{ E|% #^&h@YYs_JG919k[:o:vOO jpq% ߎK3r&U͊P[з㗾.ay67[A[ DCH4-DkDGEt=EoO CpK >JăT[ "KrJ&Q,Q*qH zL2S6-e^v_{%lG #Gr\"5|>wǗTN49CFFT".QD+7iZ("r\'7r!w2OMrqA'p;͝Vkm.p6 7Ath_sԶѶhTdi|&Cѷ`Z҉;@P%KLēhs|hɊ.V1ك =KP ü zh-D*gF x |3ŠfVcSPgE?CU1VY{ g%wE(g/ᬽ6O1QW,e%N<l|i-?f_2ӦJ7M_ҟerɋkrw؆ha3y i<~H<7K0n]&xZ:E6ͪdT= R9 2*bLv(KHOVCѯLz#m3ې[('WVL7&h܄Po>=z݋j>z/G ɣ f,A?ws~{/o8<|e8'?ovD¥IZ1hX* ?=zRc x 7eH jXI0Ξ% =n w7}p?G~*_ϴ{7Apw/?{ ohFw<2ײ 0*8{Sjp3IVU^ ^\Zj8u[j5`K|KЁd5~?%GK҂aSaQ+K|PkiftJ6'i_ ;[ͨ95#JkFm*j 5;@4Jmk؉iӬ5][;:7!Tс6 Vӛ_-V99 J01i4;Ζk]Nٚ {? 'WXu쪓 p̐=~x*v G-Gܖ6OVyfɶm=A- bm5G mz6i҉Gˆr߇~N?.P3ӞA{MmD'7-{ӆ1gٜmJ{2ntJKcGr~w ܦ- (Z2~+%VMS=TRN󣒔K/!oRNWAw@ izcL?/r/1/̅#D9fمz`B: ⠷m?lRҬM%= VLvT%$E֟xO¼x.&rbzUBM iPFWL3SSix: ӳj}&tp.R.ߦ\s}=TԖnkxG}tZmJjU5lFGU((gD,Gг IбL KfmfwA-LBCr';%%u' 3 ̙d&9-Ю.r(l5Aῃ<$M_ Ƶh_JbԌ}/ݓkGb23TZZt{\FU256K١fʏ:Zn'nKݐXޝb5g\fi I>/%DO~s>d>y|>_ȗFs Jwsވmfat2eɔL9sچҔdjDL% Ҍ;-"h g>|;J)夑˜db|F9b MckP[mU5RlӅ959_9w r>zgY]vKc;5cKe vUC~֣<ΥrޜJvk*Ysz6޽nһLX@t֐e&].fٕj<犄(RHAvC֎tP'v6 A'N3x]#BХ%!q'?dw T u`%ڃv>E69G>Aܭ:t䑚?& }hQ t%{t uKSpO/k_m e)up??{ *LOmQ~{}jwu$,_hvsv#ٗ d9l$ٝ.X>٬"jQCdԓx o3?[ ohpgM5< ?;I5<幖0+9,/5Q;[sY̶eZkez[ϟcx ɖXo /hpO7ݖ&&߷kW$}v1 pߐlv'qv6 }24J.U^YCe3._жayW|l,vW | r1jKβ|᝘ֿNk Zns{:LӒcܧ;x14Tˇ[nbCTͳJ5r;XJՖ u=d -e[K V! &dR0jҽY6Ynixdc&R=ls ),2bs-[9% CeX>1SM%{Bo039>`7WLOUz]fLc)qs\v[.cik,uunpYwל]ܿ]a'wvppP-Meorg{3xcނZxje9cu9OG۲/%k[ЛkFo;1/@= 4ME+̔=Do_ (1NLS !b#&`l|'B̍(;.Wbal(3esٚ<$YG DmdEvd_9Pȑr,(Yr,rX#%r\[vSF,w<4rPmrz8~ gIK8/s&\/u2 ~Jv:| ^.uz0n9ee.4tWr%n/u]=^2Gwa#|n`sܺ.ҭosStiF:=3\n=S64rgt#{+ujd:ʕi:u>jbu!jaȤwznk+V6Vˬtm\[Yrr] :Xrur]mdrur]kbʕerur`fuaӦ-Vl+߭H^VY){[)l)Jw'V~VVYX~nhr r r rajrX~afk.5ukW6FYAꍶkc鶤^՜麈D8BW#{b&iԃVHu]jFQqSy#ޜtGjeGml׺5_[WXrg]ƺ?߄1&]̿i߽GY8u5 ?ľ;9Ǿ;%݇bߝñN}wgľxVZ au-^ImPoڤSj@Vڦ>V'jTUNڥvRG/TD}UWkmOS jUԫuJV7ZTz^-VK PTzY-SjzMTk~dQD}:AoS@5UTsuj.R-ŪDV62V]ک+T{u^uU7U꠮Vת,[]TשIuS7CR?RT_GuTSSOuRP߫窿;UOSQߪIA?jS3\5OV?UjC UpKuV#կ(uƪjz@MTS#*W=L櫧UzBR߲1ZKYvR/TKu`WQj6 \qt[Eu?M=jɼOX1JN* %_vdbf} ~&?ތ_ȧYTQ+/ /T+ro??g?ۨ>?绝e6j>^0=CYc:'< (뼽By;!gPWV2bGWlw](__G=no|9;rL96},tFiynr`׿~+ֺ [nI0y ٛ[Y/#Z'd~J_a6l$aٽ>5Y86OD*Q| +bl7Cj/٩o!VΎp]"U)ٮ4ސ ah›-k|.?͟|1_/W5ZF.A6SZ"O_x ?vR:- -.3.rnY@{~LC}vZ:S0;#qG;-%C~$?N>w%U&yAy*h\\4 - 'hI+6 QWoja]*lNS *Uԙ:KWNAڠW6ه]O )m9 cPjh4D)vG35voa/Kx2/x.!1b,u0MbqTAJB;C)k2V75ȓDu3gZW!OVei}KV3VХU 6ǫVL~9l9p&U}5'NQT}ohɪ)~yȃ՝h `>6Pn>P3օZ'tC#bSUcڿq\XϒquϜC;]lvY:mҴn7Rz9.Mn; 2|!зnef3Hg VVl6l>dኧ4L4x[ށw]yދ̜I| 3 xx{a%OZDEOZDeO l)UtI]$R J7I+L<g |gjzuYR›Mmsƃ|\oySD+J O{Dg>- {B >{D]-&[Bt]{+$ZHyRx/R>f- z.D8򤠜I1f|`,SOAn]ϧE^'\buKb0vL);+iVfJt]EO'iK.|Q b 6mDQ.=YOFl%N)r! [r 7mDɯ4uZ9NNW uF8c d'יw glsJ2+Szn=7m6u[NnWuGc d7םj+ZBW\FJ #Go{CF#m#mGLy=Ӛd":8=!=ގAЗ$s99rUGw&HN#>ՙ">ә,t_D2gjggSL| ͧw8;2؋?_9`A1IW#q-z^Iؒx u;Yzۍb7^n_=ҳ(HǹtӉ39B ER2w%jwww-6[.iH-u_tˉ3y^/ ezM7ZxZym{,]n^O=^^_} pü⣽qDħx$i<24Gx[M|@|fov+%ˋx_? &C,bT(%F<5$($DPPP[mBCw u u#5#ԋxvO?~ćFG|lhBABSBħf - *_* <*л76/m4+!^OЁ!_)~:~# ~s~=v~G ~W~߇xo??x?M|?֟@|?ɟB|?͟A|?˟G|_//뉯7oķj}_fNX1ԧonnD<#8ܜxppTTYa*a*a*Amgu_F%$H.G< Q ӁL2c@@fq yL 3'<dY@f d6@$'< d.@$3@ @YY yB ,<H y@Yd@Y d %@y @^RH!E K,K@^" E@ e /Yde@^ W,r yȫ@VYd׀5 +@^:U@VY oyj &7 du@y [@z ȟ  l6 d#@6y;@.w = yf l>d -@@>R H1|C [lG@>m@c v ہl O|d@v O| S W RH π|3 ;@>9]@vd7@v)R  {R H/|Dӈn4_Fp: zFDZ74_FJ Qr}\ЈF|\%4(%G(>J.hDYG#&z@R4:Mŗ!SL0< di@A)@ 4 P8gԵ+;z>=pp]]{it[[ѫR$=C3b_=N/(Y ۰42z86MbqL|-e˰*K0Z]D5ۗ: u+TOU4fF=xk,ѱ|ԗ>CAPkTqq%X5)Z }<0i>0=60<//V.-,,|.lWUlTRlQOt\X]NI3Z~{5C-)棶jzh؊ۤCQ=_.g5.D!ŋt옚o|S3\3(NM!Iaʹ'֞aM>;0͆K@hͥuVaVeH5<rvl5/.Ő 5MsvK\}B߽g˶)|+Kj %|b2196zّS BU_)ٌhjjFNT.%nLu!5(QFH湙zŴUu.9{' s^M3}s]O> C&֬/='[+,r vSvrl2jǟmDzY5R/q?ڥJ ~=m(Bbxj[bmk@IC)YQ¸?Ukz>WkӳӳȹZsqMϏj8=?%rհED5,Z"gAςZ[>?4cIvٷ;ЂȾBb{(kRQPRɮVhSTڈ-Kz=JYY^9|s{/h~i[!cY/`UY9' Ȟ/+ࣔ"W;UYK÷;/j,AX¬sy?,a^¹<K XR¹}}i] S 1'%" ߞ!{y+gj[O{׃{u!7߮[G' y j9x)e`F35jqd8`:\L`>`1EY9`"c^(=e[]U40fS$Ɛ9[lTc@1 j H5RƀTc@1 JV+їvt1?>_=^~/yN_=:^1Nmnm4xb!X ϭƥ$SAbRXP3i&<<<<< ISVVVV<Xx k[^lllx`m;]w|c'=O>|p!V\#!S `A=eeeZP<x/ hhhhhhA@@@@@@z4.{ j+K/E 3ֹ~7Biba4E4?E1SWzFn/F7Fv;pNó'%cG3c 8j&B,x&,F  x4qy6 F@$F,Pn {6 ǻQ#THh2%=gF=Š1Υm}>/- k;'aېI7 v[}Ad.d&1[{E !$H3҂yhA4W qHIǒx(],WC" -Hj.BdlIg%aW[e HOMlrM55J˔ ɐY ^mb%f0 e9Qp<@QiZoNڜ|SxY!)d͑&kMjܹ1,ta꩷ߕ]93w|jI |~#><1&ӝP8OJSV#4~l!}njh Ś%F8wy{;DTX,2^z|5W0J-dx).t16Uml\S8TR̾bQgO~K#'HoxfR8¼²d:kQۍA͹/ap5:@9 Y*Q+\ௗ+\<И THX'J`mLѝ6SPޤ^ "_řA&q<}o:=x 𵜔A*~>HJ0-=Jߪ2_H)BR d'ƙB a oxt+CT!#ђ[kKN ,yۡ}=z:KTPvrѢ+W/iwYkeͷu_gWĕ?mjnka$jͦQ1fIj B_!5q*5;n\#,MPQu%WDՑkLՅ~uhQ"siϷL޼C-''R _-yc60UW޿b;FZQA !+UgE}^Z%^A|1v٦CB 2V#;E`Ś+lv-B =l|"vLi@d2_js[-}INZv5oW࣍NTQ_8\ܱ:4xl^KHCW&f$Mշc=9&1͙ >v=ߜOY)f(GՍvFzaDI2C⛧%6UymssvSmH[*qjKy Lx_(dO1kfo`cek_}:\J ];Z6(p!>8y@+j튱3 i?ab~.O8ma?r(Ǜx]x%Fl/ɡ ]u|#~|+{Tw-sAW!aKNd8R#ixYhHj9+b W|zS)ab;Qy/s✷8L~[`ڸdE9q8X .<FbPPl֜mMbcx906n|!E$Gpx~omUUWQ٘0#|&#^]2M17Zqh؉Au2t<6F U\I'O _kU^6Ϻ\]Y\RΝ>bo;ܕ|ie= 2_Uݒ&Z$kί4xD JX[o2(d(.y**Nv] kYL[ U߇+7gҶPX{Q嵆yYw۽wwO7~bpl"D *G_)/Дcȩ2 ]%ߖLT697d",$-\k:)qT](6-ps֐%d57ǧCGpPl:6IX(6z: _ϺYAԭ¨[0ELe@y\Q(T0SAQQapو/ńH(zj&Ma=Gݟw0N[j&퀸_/ Wԯ=ul^B0#>5*r}7;&B+;?=fVyjIaYZ֬ $EH%O]7x[ΈGoxķ^EF0bJ}r1JDz.Z^VC2d\e6ݷ/Z(/ʠh ]ycMn Me 'OQ1L]̑.mvm|E(%W׳㏯,]]}CvCe8mnԽ|:B#\KENv+w K|4-Y+3}}_IfP!0{U!/>~Jz3䳢43M ܢ>N"?">X3sq9v[6\kH1v. z+=+34GM6#`l ]`)XT>Hqdش-]\VSq!Yu7@y1(3PhpCn<܅* FK,ݚmEs 7hs (sә 2{ګt@fܔiQ8̳XjCuP>sϴ.w'gWQ|7;l !@ZunM:WldzObB s\yp`RK14䆢C(qSHW@* WSbvtfoN-00Q"S|D;4[JS= MT~&lXi># 7O~+#<უjkϳ-IgH`J~/D'Oa"sqcy:Q6VC+ gZ fdHo2!R[+Uq΃r7"Pst:VlNCk@(?ߦChKofVG]z/UA{}guG.uѶ'ծ޽P#YrO> 4sBb}CvځM+Zyj0\͒~mml:N3 f{qˏ<Ĉ{l*NޏULWE+KܯzVt%}c[ m;R݌grPU·l endstream endobj 32 0 obj <>stream x]j0 ~ Cq]C`kn,8(!o? L`-}11.ae0I8oޕ&*-p- ƠK . xT ^~gj[p8ʠofF;uNt0-"K_E64j*gV!N 2OUP{,yJCT>? Io+ endstream endobj 33 0 obj <>stream hބRMo0 +<@_և e` ֪k [?JnR$GP`Lh p# ZNAS77T훫}h~gQ<󀻦= fWcp*5b! X1-4LqsF endstream endobj 34 0 obj <>/MediaBox[0 0 595.2 842.4]/Parent 960 0 R/Resources<>/Font<>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI]>>/Rotate 0/StructParents 57/Tabs/S/Type/Page>> endobj 35 0 obj <>stream x=ko9?裵Gv&a}ّ$זoX|V-9bK *bxv񰹻Y\of?pv,,?>}\v~ynܭWg6p?ˇogz,J׶u7+gUW|J^lׯ޳Y[7_1ղY#ft]oO#q>+ Sv[}O_}:y^'O\8}WzjOd;,0% *qbA\)'sN6SQ,ݼ:Y;gNwUy]AŻyW_/CVq^Iwx]{l,.xnS]%&_[Ie?f~y;;Kȕf-uO|& $+sjEg?0Lj@rQ0ǘ+[#7;엷qVXNӟ.3*M*5'Deٴ Z[T h{v9Z (ߪi"’6h驙mL 7^١-#a ?nYuѥ䒰xfh6:bdT\sd>nb2枰aW-rhMs_`΅A%2ZgPB>RA5-ȉ̈́X5ZV)rLSY_$'#L!ۢy7#z0TȇoUy_CFD ŷxgvQNwUk9֘W[l_;mI\$TS ?{/vmJiE˸WsػQɂsŁ2 ^?I~^񠼳 ] E*zs2@ANzpG}eTĘ"_L sf Z7A6 `;폵`Qquox'*HK_~7LhAVDm`Ą&w9F^N|]S!b!0X닣JI;YÅ F-y"]0a@#0@ 8ZYݿȎ\RuXw C%h!>|xQ yW]r1G^ؔ{9nijIƂ[\L!LDGHb_^h 6I6, ɒ#K44J@5yi"#6b;c;yW,+H"C5kM.sf.C1 +koŢX^ӄU }Pl7d437w0]f )MUI` `^a3G̻x@VH XM1r[Վf^BԐDӁ*֔Դ=/mU&:`FD#^w^^Va d]Y*ZK%aa hhs7s5Bl0C%ǥH.:H _^|'L~#H ['oJik Tt^6@wް'9;k tGN7F cW& Rаlr_EU?'NH-uS}Q=u\Xvq46YB:Y=\lkP&,"B] $3\t*Xi0/(lԹpL(jE8t22L$]yMc̆:#qZI>fdU;mQBErnQ9ce=bRZ9O ޮh]]ԩEzZٌ ~kPAd3ơ[in`Пs۱vkt8R qKyma$6u0(fh9 ]K Fj⒛.-/): IE}Im')0GCk Ϧzׯ⋉v$Xk^bVLܬ!r>WLC%}F@"\Vi_ ZIyE̓v tƅe63'4Jb Z]t I e#zitsr܇~.烊f}ގmI" '-PѨ4-󆮟_*Jًvp~o,n?D!2|ay66! AąȵgO Qk4Bۆd(hcKnBi$0~XRĩ\M%SaatؾQyU>Nfjc Nܨ*S!tQ$(MpKKYQ ,:jbѭ^B{ \J;tgAap~!;V4MASG?~͜& bh&~O ^QˬFvOԫW`)X!y4,q-̛:YP0}oʴLz9VL٦v-DŽz(tP AR+4VC$dU P4bvf.:f}"kR!Jd% JGm)IK2Kl)*h bP+_U8_V4+hjn.Gͧ4ܫnרRD*3ۢ*Bhq-.y`y4)SbB zFx$GVQx ov:J 3sPcK fMa\/n"R)Ì6'YKx%)2/Ɓ僬pJCt>)ʬꭟeX">ʋEyq&p#pRV͌ɤzlJH3DgN .1xc 2,8];$'ۨѰC^,JȽL dUj>y;zyxl҃5.%Ȥ&z*z[IX^u7g:8_%M ~=m̮yg;ܗ Cv5Ԫ ,~E> (u:֙G3YWAF9dLgP MNS[ZZ7CKk^>RmNY>n[4kzIѸv˼mq=dD6R7%1 eqIS5\}nW71'H {eѽ!p`?=A6%guªaÇ<>H#5)dը+4o \\v #{'n1 mP`|nHX9$y7OkZ dhdxi5#v˝";:fOւp!zu/wM3t,D(4)5N杄wCu(;6(hžmԩ}QdTrq=pf;Fz ϱi@Wl25qȨS:wG HݕN.!IiG>.>y$Qv,_סUL=s:duGh>&܀ㄉJ)?ɓ)tuhh.`krmfn`y49iTJ1ahFD'NX5 -M A]]R>JE A{YQxӄ0,5!#(urK HXKJvqw{^@N\N%I$}㓜Z&Ed]gr8Y.+G1Y˼]>/MediaBox[0 0 595.2 842.4]/Parent 960 0 R/Resources<>/Font<>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI]/XObject<>>>/Rotate 0/StructParents 58/Tabs/S/Type/Page>> endobj 37 0 obj <>stream x]o# n~hW8ri C%^$ז{Ӭ1Gɻjɻv~y~;~rxm˴&8U-&G?y|'"h%&Ѿґi*a:rr?elD1ʹuZɥ>_w;#2u{5vr7`śi[M6m_[hwIyy/gQډM͡(*twwh^_JϘj@*4_#*yv+gvGܴ|lfZuL$+wpjEɳ&L1^\,+Og.;zMOgo3J,ZLhBx)L>+QZZnxþ7?ڦ33V !i\iHѤBHRA2!6Vn>uXno9%X)|[]YON;/`hhm Κ N 1Zƨj5=?ewNyzSuvB])Dd}\yOڝߘIGGd=F2'5,eaUZH)*̗ʙwD=7#]2,kC7c)p :W<ðӳ҈V?+ړҴ6X,m^="1Kp?:?jsG95]e⁴| DjiBbyk&!.1d̼)it$E!SE S֨e}ȁ M:.|n^p:Jy8;{&\/H\*%}әZ_qes>]@ʢΛWѡuf󴕃h3WGxj=8qQH#f7+Y+8+SIbX.qm>uf'WWX,%5iWR1*x,ՕH_͑/wy0bĀd. FOѼfGΥOŴR`DR4yĨIթ8QKg9Q"g1Kheuk.,uz3}Mb6op_1Pc/mBCzk,OceD{ڐ+RYC35Z͛F<"=6\k 9;!FN";rtH.R3hЏ"shrUr#͵HoCOM݁P{dKJlt A-:,tG OyU"n%'/ބ+[\ǕHf:N`Xx٦wJDH}~s5J:( (ZowzyC4ڀJCם<t}<*`fBYuV0 H4~B- ׺ CMU䐐(*NA{VyW$,_ {1A0kh(I qѾ[8ULo[* %j ;F)^_M|G'ݥ=A|o Kk'HEMyde6Å仃 [?nbġy pVHJ?4c&L{M}$hCQ4Q&Et:%(i5!)1nZHt{Fʦ1Qz K2Zuio D ឪ*nGGVy-YE JRDΔ[F:#Ǩ&ccx,MJ(Q Q{ZJ8.M)iScAsgġo8a|Bl]J2/S'rG_KO)C5i޵j,PO}+87rwRգ`$i{\@݈|S@yr/GV5i~eˈݓ2]:#8J%kmK D]X"%?Db4cv$v<>y W"g#QFKO25@S%푬¢T1-&# XV##tRBAi=h.l)+$wӒXt|p N ޸אHm.6fǩLs@wQoH}L CT# BI1E}P<cyC/tyZCY0v +/X>dz>XFY(}Tp/\(mDfen :xK{7O#.}:5sӡz\:~뙸ΡEQ~QT-A,ܷ'V=SXr/5PAKjHg+e +z/py7g5uY>֚ n ûGM6{;Ddm ^?4}8u_Vm.y3R?U:둶E *)KKR歏Yc.';_5FAjdEvΎѰ+< ֒;`탘UrA?Zr.AT~*-PpZ.cXPďW{{%up%,.?g|wh ]6%MQvHg#+aUh'9Ƥ4J8}܄dl`# !;9ҳh=J>ەLw([PG-!%1'eG'hNkn&ٳY☠BKq>쭡U*i-B$2w[DT}cDh"fCBc`IL.ǢXo?+NE3?C-ҮP?^ޯSpw[/|CNeLG ]Buo@+s!_:CP^w0w2<81̚Cf*L f7?|]sC-_g qoE NhiZ4tUcQ kwˁ}M ګ>stream xMHTQ< L"$\D*6)p(] $CKn[ hmc iN=wjZy`=9r.@`Higϸp),b+;BHZz]mFȕ]9oqMw-|^/Wv M}^j-إr͹sy0Q*|N̻4x^U-4z5g?j972=J} +6R',q)il8N(ZYp(;ʁs%g+}uX#G=k6a|p1+D(;9_C| [k/qxȂ5ǎQHdT֨pl)۔:a[4Y4`ۡ]#및_REsYpPlvaG v<pׇ:.93M^{V(4$jjjՏK=?S<[GqΑ?*鲱[κZ&@Ad{#2xNV*P<XZԯ6!>stream x횋S0ɻ" * (ꍹnnbI)Iy_~IH @\*^لU9 -s;^٫%v`+S26p+ɞH)0x)e7yP9*0R\[lz#6(7&؛l43je6Ŷ-Mۙ>l-slilvhr# k]s63 nfnRxƖv7 gYvk:Ua]밝XW~N6l~ZL~q;6nż)Z!*JcL cjPj[\ TrSͦOktf"C68齳MGwkx5& /‘l2dw12-{ b}/^ )@ٿ#mU =( #ؠ؈gK,|1nLQkC tt K-`.mlo>,G:f$|$$%%uS\dp %ؙ wNECXmƌ fVlQ%F,8OO~@6_ H/;E.O|Y+d?is/laN]뜘t nZʩG5(Oq`%I7V&kH6T*mŁ?^U}8cofK(Ù#(Q~`_,DB| "F xQf%]hnrL#s/~RDp_gTq$vڳl4J->stream xc`80T`b_!HLW .].P $X+}58qHIExzA7FL  RDS!I`wC?`ll,EmDW6H@F5jՌx4`p b4'6?M&&Mz ҈L V,X88xI"t8D/5h endstream endobj 41 0 obj <>stream x]K0Iv?f'ӁPoQA14MFs-{J!%d[bO|!j7*r>stream xc`&(b,|A5(J1Q ~G,C2Ĥ,kQ`Ls6j>stream x1PF Vֺ;ki-؋q5v.AĀI p!/q~=\./|뺯Ue<Υw;E[ɼC Z7#G5MccݟӑiJ ۶MFx}0 <3yOmEQd^)P (JR@)P (JR@)P (JR@)P (JR@)P (nRqq`YIA`A$\]וeg(${CXV6 endstream endobj 44 0 obj <>stream xc`@! y6 ǿ06%߀ryXlVnS@ 45U@1$a38? ]<>{_!۰B}00 {ga.24|VnM!+e `]=E͑pyW2b(b`?8_FD cH p3 8<ʉt3YĮHcU5Ǫ$FP OR W M7LxUCUwQf6WpSj endstream endobj 45 0 obj <>stream xVOqQGHK[ MS+YIj&kX,( 4;,dBijOƘ~{{9^dt: fC|0Y,wg\VBQ<_]]alRhIZ@`^s%4Dt&Z$&f hZRvt0u;_7eD|m γ *5(*Jv10b1N!V0AՒdtNL&8xF1 .K0|]foL&^ Fvp8.br A6%*$COh+b28N*`\. T!kFjP(~"'zwww CJR`#8?(C_@KW(|>\..TK+^rr(ג)`*n~_^#_CF>`L&_ endstream endobj 46 0 obj <>/Font<>/XObject<>>>/Subtype/Form/Type/XObject>>stream x[Ko$V ||5IߧZ CַwW̾?>ZXOGS.>XJL2oӿ~<>޸1NL4OGqN>M޹9(E7OG<>rwq V 9 1U¼Ύ’f7NUJV`\is SRW T3 <>;VguO† ,-s.8{9)8?KU- %|gִDkI#pMG|MzsWxB)Ih߅<&1`@@}fĵ6m>lOfGf9=dzn {| JxO_=>z#Hqqjq^Zb)oil^/fǮ4V皨IqsH}hҟmޜ^oK)!!l~^Gɵ=i)8ͨ@i S\nD 9ߞ)prx\@$,|,`Zl"TB@)0b=OK8ɾ (~Ot<RӤ dJ">]K\sJ) @{DwL))IzdU ,ϗ!3Zx>gn"q JO$w~ :tWGT'b\rrdp GZQCj#w+ ĉmno4y$&  A̓9R>aCk[DK=C^s*FZI,gDs9}0%7mnwRؓ9Lr2WAI%zL$v;t'B*?dFWgr_t.ʯw* ˗#J|O~",{ '9pmO织+N{{ẺV)}9?]!/_b.3N~<ͻ5{ҟw#>pҘރ/_s׿p c\#x ~DLpnG[s o^M(E©KT OE̿ž6Z0,@^Kx8W18ɵ>.~{uGs k7 pFB932|C4ٶvu _=\z}%ruK o[PW(]T(p/,/P"t֖+W &{ELՆhQPhh*}pF@Ŕ\P9% JKIKA}ݠ[eZ4YO}$z_HKS@fuDz/0BqB˿!teCti7e_PAV, n͞L~ͰM`>\1^&XU)Yz>2 &SԆcQ5V`02XWW©C=ꯪ>uK&v(#10p AYZ@X^fjQ%pIGSk+'tuB0BQ[8S:Mn $@.̀yo)T Wb1|é*H bu0ݒ*t0]U3Cyc`,V: Ÿo\i $@qPTowM]|Q"srN9d#6#<ڡܘV~).F`MD#b16DTD$f('2x9o} ޾=@"f!5vՠ|iX5nl*P&=C^4 iR#jV,7@p͔Õ4gd;QpXqU5&2~hori]pNz2uV .NQAtI"۰Lh2k [N^9IϫK*78#wo\@,YHK޸8#J@LpvQjFL Wż|lRH٥ŻviOȕj8j6@)HfDrh]!j+2Auج1+k58*q3jfCs;rk 1t9dhWпa!$r*ʜp:S4[_|:M3ǞJdG- z1*]:!PVSۿnH>[@,F>^D9vmrfJ+[h"fhMQ/-"~7(|S{ȂX,9_dn(u(ͭ-EmW`wۭ qWLwZ>6Nꥻ骹ȫn/>BJ/ ARZY:}" ,Y`,Jq1D p1<>ּkA">McPWk&p @R.8)%'*ƗGuJtT9CS -{# )>5Ag+sɆ-hDƣ*er0W@Fý@dLQUj̀uOa _@0@ibb}Yi1kzhհUp8J_! fC#JhFHS:x&c#R ;lgz J]7X9|\ :^ȧXax 3Gκֺi^lD/*{vzX'IdUpO2= &yj5bd%խ~sp,WOl:^qbM.PJܼBU8K|ez/A8 ?,,/4sF}Ӌ$ Éȥp[Zo؅C_6^{P"_>j~(ſ@\J,C)TR]S X}%cAM=OnHHͻ/BG}r_x'͛~copL7=문:ᗏʌsp7(y_"?hI~ĿEN*O71XǓ%c[ zN= "?[QК|sαLqrUQУ]-y\uK_ n endstream endobj 47 0 obj <>stream h242T0Pw/M,Hw(q.I,IONT030003 @ endstream endobj 48 0 obj <>/MediaBox[0 0 595.2 842.4]/Parent 960 0 R/Resources<>/Font<>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI]>>/Rotate 0/StructParents 60/Tabs/S/Type/Page>> endobj 49 0 obj <>stream x=r7?#g9)Չ'=UyHaDQMr%ʉ/1$\ejЍFq7nIͦ_-Γ_? u ]]TV {7i[V؛@k7Qi$D'Q܉MscQU&Fmtԇ'B#|MɁHHJ޽jY}WT.Ud;8=c' /cYSD g.9 ۿ}?vdXp>nV&hETNPrv f/.x=[+NYkU Y+jL>NY6F\GGZKHM+Ư>V&%Ɓ9=zŊf|5Z؊P񍭃8ܙv@P,.c#wi)LU_{m-9Blv:H%W_`7֖__Ǎ6b3p8 [b!1v+;l aFkKe~b:H ;uqa24! s O f+n Fh*b?;6kʒdd OעyP m\v$֌%>fy5T$#BU K1`h$(L&gsxGG ʼP  MV{)RcWn2%e&LG6JaX\A_2:%k[(4i*NNNƟ1# gMov>Gݓs+e`$I`$|fI id4kK+❵4 ?q-5@H7]q-䯐 _p:v}jʚ^c*14JF?^2 A+|ﯕOu@͐:Z^oǃ.EkI9N19=֣?:b ːU[d4ԓa䪍K[g2eE]0 H8W WQˬC۩Hz5(A:1*WzxVYbaJ}HpGc}䮯9u\#3%ޏk&8/F$CBSucuF;_)KgfJf43Ic:$ƙx$؅ߝ;RV,f/QY?$߂llq+F׽J@D>j3Ȕ>,OocackqsUuh|-~q~%l]w!tZDlCdܒAɃbR^0֮F:Prab<'-'pԑ: R'E! }H` Gpx-xCVY#-5h^gTJ$Nt]l\ƺ6e9MNHq(6DAcq3bEnˍ+ːCP#LVܬЄC1DsLލ4b3\Js٪-XbܞqF Pr;0*>9Ye% ͖wUI15H?o8+΂$L"i؍ ҈J2tt/B|YAHo6ų&i&iKTv*nr ^&mu?_h*PJOnM{=⧵9%z_?'ڇuO 中6Dą[pY/|H eW4lą,8p3G434,({nS D1ab=1rbԐbT}*p E7YH[JMvsyN/gͨgYآ1E>f 6 {5f2wx7ZGvj6~LD2"@ R 7g g4h xD =c*tiۮV["#Q*AU}8"@aID~{Dd>j&8 620SUYYEl bFXذ>`lڷO<7·PB. $#% {zHwF%->D`FH³ ~ހ2LܜSJ+.Kw ڢ >ͅ3?DK5B_I2qjC8y9j[⎍Rdaʍr=<+]4n!;TtqaB `7 w(pCf5):ީ_OD%$;帱Z՟f2*v81'GH ,=]ס !V-̟fuq?CX40>k=Ł8ΏS["^D>Di[9q1on48~4Cﱍ5V0-L~`ێQy6o-]ms~ #CI[q;;\${0@lf9,+sO9X*7nP3_ |w2x8[R.+[B |{%W "Ev/cz+yΞ5}-S m3hp63{˰BxSN~C(C"sE QՑ~TU>ͳALұGw2r_j"KkX^$. %#JQe L};jι_FI;"Ϩ uXj{-D~ Vj*-|*(o pW1$T83sMI⦽J"smנ_NX!羶*[4n=arlEa4[q4t bwkd#w+e.`55szmYsm~VuyȻP֝d`Ʊ;C4 c˪H%0r'T ÷k:+#+Kڝ6Eb'=lwKyCsZ A`8% )`AU;[}ة p|b!$E;֦kT!v4m{J&} 7[¸p{nb]2w3rcoH ? 2HJO+&$ίH;Ųlȇ;[~Ҁo1ӮJv>Jf!vUCđ%۸A]²%2ˏRl91]uȋCd!X``Wsa}aw uC~QUc҂uagqd=`pDd|e2^y~iƗ,NFǏ *Z*hd`Sȹ ZNlgmtr,tB6-t;X5 xBOTga#h~ D9,&xY"e2֟X:z̫['q>&GvX9Ǜޢq{BZ]ĔA>eĭخ%jĠiX$ \ֳmq 5>t#t,)f{s̍m7yޞƒ:)+,N4NPpj o.OFhĊke+=6֏5.<;sQѝo>S˩4[5 ~L 2H{s "h26W$NdwIieՉV%l`K1L0? ɮ=hGO^KOT!϶R7!mhxGX4f.Ky3N%l%wKclc<%mT۠ }? $y,h|tc hm7{7SW,Ns晫h;2i~;;8 Fَp/=v_/X8Am#ZӀX>rKϦ5/>GM/!D:ɔ 6O e4T(~&'-M=]f9:ќ9.M#RX&H9Ź;Qkp_2(1tY2~M׌.7A)Mb4Íxڲ,ڬ5q3l]e9(cQ$)`ks&sYIK9\O?m<`֤W1H9IL X֏qc(0Ёd9Uj*p endstream endobj 50 0 obj <>/MediaBox[0 0 595.2 842.4]/Parent 960 0 R/Resources<>/Font<>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI]/XObject<>>>/Rotate 0/StructParents 65/Tabs/S/Type/Page>> endobj 51 0 obj <>stream xko6{}kE|HMCNO/b~ti.0w{E^JUMVdeSU#e;^9Z,qaX>O}3:,-%N~j"gA\&_\v٧eOe6'ەBײssŝw=[h:F.[#_ EaԑU^ yჶIhLr̔6'nKc#V1`yDULĀն˓Lޚ.W  |$30G\QxJ2.ބR~,hO%( KY+\0"I3 %:s[kE@^ #îw|+:*7>Cz+|u%l#!l+i< Xpt |f7 Er+y^VI e=eb+0c;Pև R2(F N]ىG$?E[-ޡ=)xy(8ruzYbȘ3$j@;˟"NmqJeb:pw`=cpíG8Z?P*'YAṙ S9&%W6\~pI${L'7r3aź| LhhV=5?6ڸߝuGF6izjw_P yL()>I,`t!Mj@:b%ktdl݄J@1ݫ35a-TM,grhodp(<>}/h4#*wǪxgT07v v'[eLixg}:(  2rz|\S_xeq)~}EAO~JnB:{>P.0H}NͬgĤu'j:Fh\*nQd,g+eۛ J!U(jrVx, m$aFVepR6;u-A9]7z6I[s5dn$ Hll q u1C ~p,BT"j6WMG=t0x|&fh:t.5(ta}wa^=([ozTdw)yh@>;N}CY]1޼hMY٦aI{= ׺{{B`0WﰪR8̄l4qrm7A^: +mۏ s,55aaIJUW(GQ!y oK չ,b"mJ \`ӫEXdW"w So9/粨 UFZj5B|( hQl &^+ MpDm}au£Uw?"tsnko ^ >stream x| `SUw}_h)Z ]RJ KE ei4mc$&)nPTt7QquP732#y94%}s9s9η%i CPaޜ҅,H{% sU< ;D.l0~Jҋ˖U/hxsM;LΕY'#YSwӽ؋F~U,K_ߣ_M '$T -iTÞЄͿu>?b(! BaXpHQ 1b!1b!1!w 1HDL$THca b T0 1A2 1& N=bLD a lD́I}?8وXa*iX"0"C;(RXC!b93V@1L(AR?a!ΆUPX 3ke8f"΅Jy0 q>:B<@- "a"!6|߷`r8`!YPx6,B\ρ7p.,A\ KW2DfXЈh&DBl}_A+@lsp.yo`U`BC3̈NADtA Z= ;+b+\"p ^p>kx)ׁ2a5Ѕᕰ*} {B pF)lK!^k73.}:2-p op%Mp oGp+l@ 6"}Ga\x'lFp-=pCG 7 >7"n? A͈í pnGw m`܉(܅܍8܃{z >}i؁ <,<G3|v"^a=8_=Qė1Wq߻* ?A/ x D| B|F3<3"=؇R }xx0@A<" !3cW#"4E XW*!A]9nF5)mҢ#?o`Ç jiST F*GIA4,X ;~`F iT:m Aac?Och$NCтTA4,04bG$)`G#Bi)95?&u#B% %:oL1RaTJ$#(9.}#DCpNh`zGLT*c fiSzf ;!s#6">8t̘c!sGLV*BG#clGJPYde)0 o(JebPWh$$1LV:%JeRP!e)w4O*Rт%QTԠ$h6N+=J%/x4LӦj |gF_'nY&ˆ?AL3IF3ae+?bRԵp4uߘVXVZ?E Z>IfiUuR !85f%NA]< x%!~nv.: [O| /fliS 򍆼ܜ)&efLOHƏK2&9)1!>.6&:*2"<,4DըU'a)Yc8?rWWV%~\>5.:1Գ!5sU&tM-.ŞZP۳[۬=z5z}6z+764wd o\U#5I5.oʅpEQbcts^h,.cyH*RT/wKŝRqT̓R1G*fKETTHETJF*TRK\̇1=c~cwb~C|?;0ߎ61_ٌy%SbT쐊^G*nj%3D*R N*1 0"'0?yG0o|n̖!!ś{ywj7_ݼI١lnnnWh7ܤܨttcu)d].^Eu:NS8@8kMP,xhEgy[uKf'{KUl7%]\}E*!+6eS$f!ouOxR Zĩ{_lZ7ͬ5쮇:ӆUip ƃwe[߸KVH.,Y4;1Y|I* @p< "0ӮYh XW$=;K>I9M1/c&ܥYXb`nD|B}?bXT[ZʡE,+ό%a<.Gpw&O)ۣ>e%B[trÏ$ sc+#vނ>ÿH< =).eHEyqb#"G8+D*nM AMXk9w:bPCLٌ~&"6E҇w\.7NUp՗v],ަ o5h ȀiU αeyp{.":vQի4"MV!vki̓$+Ѝ\]< sz5O)&d)>M,t7YryT`96|xUZxծ&O>^ufdOn+Cۭ]%^ݦ#L\.~ ù8pYC$ڋxA}[Q_B&S+QLXWgGaSͯҾCT>~/03E7NIHI_CZ@}𧒵kS!0zTf4t}0/MJl(XNJ"{\/2Aq h>1ctMYq1ў"up͸^n"^"}Rcb0Kԉ}5%IÜ9M-H$&0ď|5)pZ~vh1W&?dDLLXg y~M\l_y"WGD)OHL33<"wj9J3Ӊy٪P1%aF~DGrϟ]Q/͌P49,lae0 24--*)ϜDpc*M\Tyx\?j}hjC)|Lڴ²h'ܢȳ.Y_&rM5YT[S/K!ЗT&5ٿRdnҡKe F9iRf48`jx$ IIZ~RS 30B;v'dPL罛;{مP7Gu^ZJϕ'$$.x֭;$3HV:s?{rϭ$b~o][>֛9:CRbia?rϩtBCȘ^jyY4+_/Щ ysqKYYڀ WþúqdA6ʝp[en)9F!#S'eLTXTR:\!ae3ºuI^i FJWT\RZV;yJ>,2,ċdAeؤk"r<{b`16iE|RZL`;:-A PQXT,9zxI薄DR7'ID&ڌ8-Ome#^&-כ.[{򌐨>,q,..d/InҘ8L2|1|;'c؁c\-'>;TQD^q-*k7E4k5Z>+#rƖVZp\F(yÂY'ު%i\ 1ӎS&$BS#C+C }82}:6zV֓tH "2QStnyG5?X\@ q uEyXSsEw ?os۲e W۳›!>s[zv^쳗dڀi+Cux;[TjܾWFh֪PUЏT-ǔLV{E1#&=NSU/8_T/U3NoO/ғ7S~>%O7;y~gݠ2~7|GM0:ZrTQ QC?r]1\ZM\AF~gaP!# #t붱E!Vk=% Ćdu"7uuU@k )uCCh_aP*瘟Y=ʙT6ؔVIecsX=-}"RNpyBX$,]#T9\N:y,MXlmmŢ[t-yKDajZv]`Vh:-u:D`[6ˆVv!'DFR .knٺǒNbvw0rtaIy4xL.qfG&vvAn8 -+Ci*ry$(GpWn \M4QI09%*8]V(4AnutQܢGpVt8:8i尋:QVڅ5wzDv{t(QL6;у(?h1EhjfIK+Gh&6!e27[rJⲮf.zSCAN7y:0!Q0ȻL'RQ%/@c̴ sl; B ?zX;mi1[yOQ$$H%,+t5-l3xL̆-{Mu9rܯa5JgFs,iJfXqi9 zB֩M0ỵތ4V~w1Nͬ&Y$&vFgaR_ci)GP6;8@&^d]iMY̌,{vdjr0|\s_'6 Of;9sͲsdm;t N٩#Oc)+VYvɧf >zD +RYD[9%EPI{YBFcLP<3Gifd_!Mҹ,'Mj{C@9,%{]JYKɬhS逸Ivǝ&s$4|A ] aޥ$:d-rf>6斀IC}naE>E$ZXĉ'VA#[Qʻj&sCJĸ)kkc+BA 1XTs/FŢFXgo9ݤ5~([6h9|C;U ,f+.(zj`r_&k]!r2,[IN}H+=z丰"]luǜFDje,*b  l˞TTR,A9lux^ fnCG稁)G=e k n8,qVP $MڒngC. 9Y4t ,<$Ev#ʷtlL#I.i#C[Z:^9NbOVM~RDugA/ج mYNi{:F< `/pWfAw(iRO@ PDEL(>_tzWN*Cv7>mu6F2g++*[ٿ0݊fbmtW(>~;ab4C@_ ?,OT8/8O 洝7K[2e?F-m]lf Ѩ#y.E F&4[CTd]1GT9-cv,g!*fLPAcz3Uְ0n[,ש7sg3ᶻ#^>hKK(W_qK1En[={~16j㴋EKngK[BN5j~q<#v SSe_d,5N; _K^Ha aq O2fHUV'rFi8:(&hZ~~Q/i45H_ב &jב(Pn!pgՂW}B#ik(;|gוty;\7щygN+C~{ɑx߽VS=!#~z_[xoWMluM{Έ׻_yYAssb L9iau=?kZZ~R;v wn5nN|dv}/-7?g{[<¤OU]v6zf G?oc5ܒ}aYrߞyWtүf|3듾r_ڕ7,x\Gw#!h1 MJTG}"e7q񹯱JӫkZgh_'d{/e\B ƫVJ첝J[ _S/2'bT!QÅVk Qao>@tGPC(ٺ%*kg3aMo:8Gn ϻ|Oƒ6']}7ǶdOn?wvEaןyYճ.1ИO|w{E7>=7y7UT\GkϻdދW-DG=E<~~oOc7{wUwӎċ }y,syUy4u}< AzK&BUJ@zTA EH1((H"RDD7Y}vϻRnnfn2{fFF^#ne}wnD(&eǒ>6a𹿼iڗ먺B9ª/4W5BԬ?ݞ,%\Zq3a0C~|#||"i j`ߩPJ2$ KIrX M!ګv|D;](SiumgͧoR,?+vfI@$N'E-*$.u194{5skn";s_E$mkVרA?y]r{)0i\?#)_o` ⑚ ϭ[QCY︲h֏1FH-rt5 xr*-Z"Taܒi7p.ᑳ J@sfQjUXpo޸B%vS^)gvN߅{D рP|rHy~),8FQ@qXDAM޻WT &)ebƟ5K#4Ili9]v*q'2&=xQ4b.$ZFzj?ăn?8-ۓCCr hɡ#(cMu$17n< 5׊&xz/'aΛ0)j\I6p|esZbxy^ 1$Uc7sI/f3ͧ 3#FpʷQ??ٓ/-wMӈIeDN)Bf^ ɣgiۉW_62,'Yh$Q 4ZzC\NZi^fEFf}3*N nbn09  J3;v+{sVI4|^lx[r-@Q45_o4i[kFrEԨmps 7oh ãO izoR6#@@ąCܮPL@9Bi07V}^{}7zt۵53DQ2qkV aeFMiHE}@Wh׎ /bVz su&>]|H"z4|_&Ki}rX=-^,fJMs+TX|>&K+1gٿIa!2!"߾crwv4ƝvtÉ2'[ &rp~` ?h1Մ_u wK0dFHo`*(z;1C輇$Ip \xDd6Q!t44e1fm_>-Rtۚx%jNn@ ],yBܶ,'&VhPuu r V۽R7c$qXqXRxS$o4yjL9ykmH?ٚ5/ >WQ((Wf62-]}:hb\yiε[}aH$m' O* - Hл%Ixf릂b. Ǥ1) AN]aV}zi\3 M? /~42<"_y5ӥJS\b(}Ӈ( 7RK 1L5$)-/\gMw߭0'1 3:ery4=5Ez%[x4|TnE`,l;C+9lJ?t}lLS#tĵ#>stצԳJ759VxI 䵡N+!6xdQΊYz׎(vTHw 3 \e^lQ #{/F~BK~#I -z6% gnګ %BeܣG̨n_yʋ Mc%b߳qJ]i<ۆ/jUG!j [pi!Kyy? Dk/$J6Rr^:P? UnQF@QI6ݶ*Tc2H i:AFƳzdU= 0-LyY ^:WmE:_] #~yٲǞ5G->Wqİbx돽O74&d+R!eENU.m#${q2TGp^M ŕ/o(9&/-ž gyT{]AZr:UAJ¢7z<ںt٨hfi\RrH3MW(n2=h‹Odڏ\8r+׎Qv/,oq龈*V뮋:vxms*!4+[}f-筯 fphOW2h;'ial<167wtӹj>W$/ZVIqjˊ _Zҝ,(+tbW'IL%ɳ,U U2{]sa@rMfW ȉ~0b:؀%e'A u?ej1'*ߥן|_'AnIՠHH7^Z-kz@";@߃!!C@Y~<'4& b6N;:8c)oP'_1o@`@:/詽˲= 9~E_ Pfny$&s.G؉(mu=vOqFS#Nn,DMCaf]5_=* *6gM;wS Y,K Mxj@\r4o}],HHYBlj*tuMV$oL5Rul=rE# CpƩNѧt䈻ۻnVԽ;oa! ?|vkLDTve;ҧN@ >AXH@ LJr^dVH!66'[k\'Y6No S"&xFPA{auzo\!b&aZr=HW2'$YW.5P\\ƽQE'cnB`{PFݡzw%@o4gfhsnt+lEV˵6 tN۽;t쉶D`lr A@W=T^Q=Fd0:&Q;;{>stream x]j0 ~ Cqڝ!0R 9tdE6sOB '~Kݥ#@q=&=9%l(϶_c)A2f⋙tݧ(̟cҟ~p"PՕTUQHSh gSvW׶CٕY 9')|~o] endstream endobj 54 0 obj <>stream xZ{xL?3I$ɐD+)%!AiTJQ|WQJچZ%J=K.)zVQz#i^4D1sk=s̙9qkkk^{8N 4hРA 4hРAX;.x==?Ok &D|oeCxw>hhkOŬs!Iji}2(G|8ސ5'5υSTVHK`vA Mf,Ste'5b0Z; ևb3hmx@K&4KQg3ӊaZZֿ̕ʻRDROKpoa*h7+ЪF0_j%|Cf(.R5Z״AF%f*5sutS96 IG xf9iE#J' CyNnur'<e$>;Ar&=w ̗%V84UN}w v˂jh%J*.7w2PϞ! Heb^1ƖT){-i-]Qg ꈴ/+deis0x)8^_N?#l>r %Um%~e| 4_o!*Al2$Gd$C.6dK0tYnNI J$yh"t:?W,ß:2JQ̭H"wY>wfN>pwJ"DU2=|Ņa+!`E nslU]AҐk+wz1ApC |+cd_S6ȮnJzE#תCEqn,WJ+F& L*&&¾JX D}=EUrbv\cZ0)U)|ɩr+ۥ.#1+2,ThЄFeX չg܎);*F f̐hXoNnKb&<˴1w dFY㋶ꐪ!SF+QPEblYF /[±d :B DQ.8ر_s05G$?_fCYǛT`)!s!P^y"!\/5#WE(/?gU:8 ׋*yx)CH.VpD:l!Q,K6:t}'U*&VoO;90 Z3*pr0V.=9V2dM!gɝ*0CM ]&&vMt귑GY9Lɯs12d5{Yw(/Y Z̵79H-n"cAɞLx D6ۆbĕ>DJRTtWǗt 9@!cϋg3lyCO ֻkxsatcm<|C<%&Xxn%4m`Qp'h֣ 2W]L}43(axl$GGP+u+Agqs+{8f!3hxs9P%]dU@}OkI̩.G2Y !$U3-kxћh ,C Wt%JVzv⸀i1R9Mmxq(FǍڤ>@z(wE_,xUnFxgTi=d3<>CX7~phꎲ4hРA 4hРA 4hP/eN endstream endobj 55 0 obj <>stream x  Om7x2 endstream endobj 56 0 obj <>stream xiHTQ}J0I*E,CaFEPiaeA)#*2KHPTBY┖=oqw{y~s}0111111111111_Pɭ,k:t"?IWmVJ8RJjOr҈HZN)8%)ZV"}.M,e~  M,="{ !]z{;J{ٔS/& h]MI"wXRUK=iZ$z3&$kHpEf|D8E!B$&Zq!1HP6`dZ'b-Vɰ␠"ɚY{E"6$YEC h$5付1q)}'tMz\ &I@$[L<[k\+~]gm1Ioi4$<ՔLdam4.6㑈4~iȈt;/q,غDsyFoã[RBL:a(y?"G:_Vl3i{p)DF5+e9^k+ R;g( **r#g<%V&<"5x8:K {R&6 Vg$ je>PdGt2j*"7ȭTkH&&&&&&&&&&& ̃ endstream endobj 57 0 obj <>stream x  Om76 endstream endobj 58 0 obj <>/Font<>/XObject<>>>/Subtype/Form/Type/XObject>>stream x]Yq~'Џ3تRچkwvICȌ&9C2L}GDƑY˱r+~vx1rHy=v%zjtl1bOO>=z̳4U^GK$)T6 m~v~ !) wCu=|/>XK1F<XƢے+[B?'*CJD4vU]V1ǠvKf Kb/T[ B/u(6-=aHPܻl|5Rį$O*@"Β\=cPY'@Ao: D}t8 \PUU8El\qAG*C\+kTb bS@(V jI(I ԚD0 T%JR`^IN2JJDU52ӫK@YǶV  23B%ɬnH5쀐vцwu ]9mf2(n~6 yQ5LguAwK@ʞ0KS5{4 ȫ +KCXZ !@^PEI@^CG%W)+X-]Q\רVFNya@3&79@0 Og` W/J慭g0ⴆFa|g={YD#H%cRi.~?~qx>M./r9.HSOl'_~m??]7ﯷ-'b* X.v#̝:QaY B(kնiąpY[XW#24bFdh `|H[b1.:||VՅX@^anCjr[e,#] `@X8"F%8VGxvd(>0P j:,8)364Fg̏@φg>d||֒\p%`Rt*술ܛ4aԳ$ŠCtuv/C3-GC5xMsjt!TGxnXeW7 lpN0@pt={`otP#Pކ3GԢ3P\d"ѕ q_&"yDUFg4@S 1ڼʖiӢԣ[SA ݜ`lkf}lOnقb )rTG2mf,܁aA|{(^\#y`,OTXL7*e@,.˱qqĦnBO޿z{x \<I?~<\>*??͖|Z6Za%6'u>CSSə"|%BHm3KnEQ$?*dcʁ~iIF>9`qÏl>E2>%ƴiqul|L˗2SQyr~4$4f2QF;>|`RʶpJ)KR,|m3r)y,#1cvz! 9iIW 99VP(IQjC;jdىaNhb+ ino#u&e?E|.pw6g{}O/3y| 2p7ǟ/oejt%&!I ;<"ϰ?]|st~hzVYDh_|spp}"bHgH;bw!ev]|e|]gצ7.WW/oQn3G41&%P3U eRHg6':3gs n.C9;^G9ս:>eGqKv'ilZLx}';ճ:̶vǎOtff|36@\_e=|5s~ْW\Ȟ=h_A+ ^dxl[ƳNAkj5pZj.ՙtvO?ٝ \.Y^i9v|?c?=w4v~~_*?оyZ#~{x;Kg \:N.OwE T;= 4o{3p~~zhB 4fja?Q2%|?ZS\*,L3T Yv.G<T6,1dAƻ^bC"-8{$0ﲰ:k[㉻~40i-k+t0i]S**!m'Jvsd>q~fl?B ɵjYeO3'%ӯR22Nc1-7Ѷm\ O׆Ed9JY`4@ƃF~`Z; $ `fnL(2* l%0'G>[ǧbwN,FauťǝjOu>T؉/˽d-:SNrIpCYϒMtK\lڎ=X7]$>ӱ9+/|E4;UVzzźcU7ЍrlwN{?<J 2`z#R BDpKS<^I<- s͉ 4$;i?0i7rbonh :MOO GQ ^2\_-bGqtpXt]|ʦt=}}c ]exԷ/ !'EخӏɼԏQ5}r/{JJr[[PC7YZ$[$*Bga# g_1w`^~ORJ|iμF.|NlG*b~4SCyh7/CY;Sネy"``'T8CU&-C͜٢UFh)q%Waŕ`WJqD/R J GRq|cU4-m*'{M{v/jiCsc6S;mB rWwX Di7ﰁIm`ݲzzSu b;@}p޹}vmǺ{]8eu߿zzEf]ɷfV}"Nk\xr/k >7T\NacL5YS bB`3\G}{bh|\v̙|8G7Gq9Cw_$\NwGNvY5]>8`;MGOCs|fJY=14+ξ>;ifgt4<^HJN#rƹsd438&Mv/Kzr8_\꼡S {jt%nӵnNΕ^<_WO (C|tss n?'swޜb٥1x{rޣ~g_ۜ:n 3@YǮRyiK_Dj4eaOp_`P 0$PI=e[ckD!yF/עyNd {4iUe@B*גm^QȿK-N)erE} RUY{UcӾМ+LҫԒ(u$VLM'K+\KKA*Nc7? ,9H#z3 6$ kd8vTfdD>8ʵx%qj[ z5?:o q%~4d. ʵCQ9nFC UA-Q=d6իr*BPPŔUg3 ƒŁ}j!o^@V:r> ^ ,ȉo! q,}e&u2" Ջ!t.2)@Y*B$}l(5Q=!uf7{NTO nxb^;/1K;D7Oi[/usn74Oǧ}vI`x~68KR7} 1+H&ZpSwyPacC*lvef>c=snuauIϖ|Պ|M.s&uT)muȕ|թ|}N,._=M.3u:UPuTkl |]`jNq:4ס&_{Q>_G̈́M.xAu|Պ|]S,_7ٺ ]Mu|glu9Z<ϲuئdlu9Y.[G&[(edu:Td(lVl}.GU<}Y.gQ<<ϲu]YMnuhvQϲuM lgPkve8E:izLsu\H\].S,W'rR\].vv[suv:.W`JeEE\|bg5WT;Չv:xMgա&W׺e ruT,WϺe{9ruhvCM.۽ÉMsu9iuJqMru6:6:Չv:>WGu&W`ru9kGUruN\&WWsuڽqurV\]ڑrU\}.gU;ա&WGMjg:suYsu].q۪r@5W.W'=(.M8I|&.Eԇ+rysp]|\$Q4U3z|P.zKQT\8&`Gl|cphV%K5Un2)rF 2I—AXoJe3p2ȍe4it Ɩ_ד;BزhESy[ĜR7鬁#;hNspqRqAΐhteyυc9:eg5:d07O1f,4$o.1+S<@.N%ͽȦֹdzp3ݨBb6_&i%䓨-Fؓc, H@quߟ>mu" 6'#:w!"P72U)4UDtV:QdnQG%DajRUƒ~Q'/IZ5xB쫩Ŏ]jDu uOu(c ̑R4ҼmkS7"W:BT`kS,uSOԉ`NSu.&4=n~n(6 INؗK|IOQ"12F ]))M+F, 4l9΋T r`jthW>4 n_QIAl4}\p3ibÀY})F5Qoc] ^Ί*l 9%=mT8ƒA?RuP{`_*ϭJЊ\|SD0̯Ni>n"I:%KDs? z Iv  aEKm^c[qz\"ˍ p5=@@žrxi\ ?x;I2^n0,~ p̨'B\22ҩYN{O=PVI4)UkWFLzVWϘ&Sq6Y So*Ol-_ ;:29zU zY:9{uMeyGFX13,}XaI"K^p}stk"CH] f4Gw,켬2S4i(SUV>m4}il w\T9lٻ̃ӯvҦ&?qHnf\fXFW$]6mT<׹z Mcm#lF CBR j1,Q [h`35I"jMeiWS5!ڴ h7Jiy*N۔XrƚӼ5@!4>Dce4*~H4Lc4:P1%.UWaxe]DLˌu2]Tfzk!nE? '~amxo~{yu{هt65r(lVDhV5K 7[o%ۚsi64@;ҺvC/j endstream endobj 59 0 obj <>stream hތT]k0+zlٕȶl< ;Hd;m!_H: 9].be1$pDc9%`0"`ܫ V烆/vЯ2V;["tmF:>/MediaBox[0 0 595.2 842.4]/Parent 960 0 R/Resources<>/Font<>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI]>>/Rotate 0/StructParents 66/Tabs/S/Type/Page>> endobj 61 0 obj <>stream x=nG|9Fӗ,o":8I(آV6ߟd6)0Eέ.]]9zu8_~z8ztfy~qyuX_>ܟ?g~,J׶u7+gUWrjY勓ӗ/ވY[ӏ/_se9FͬBT/暷;?ŖvYYQtKAUևCB燪X٧Í_Yy$eUtOgQށmWtscQu!tmOO΄!51ںP=,_CjϯgG^9Y׫/jyZNC UfEQę!Wz -F|RB$!>K#r#RvfGa~~`y}d5Ҍ2W+P*F釲lmdO`,x[10Q\g27j9?Z-huQѝ?uaP;_g^*4# $EV# __ ` q#*/K:>Y0>w{=wAX7 ~Lp[wy0_pehmǑRniYN ǹn܇vfq?>E4^?uUUM ~De$N ȴ?acD^~$FBlFtքI{*w~ p/kMN<̕?1uErs=}Nk,ZN'o^͋h w3t$W:Tp+!ꄆTO!oȭt6a$ 삨kܥ!z"1GR5I;Z/}g9̩aR.;Ⱦ->+0Kדl?, Rqd+\(OWb~? ЕNh Wq_-ձnɱulf"*_U&KhI?{ݳ @ulauJpUkCQjzոǙ<渁Bp--6Yp 8Xg}Xij J(O`먈qVl׎pW3&cSjmyTS-ɔ`*0\w5;sGn%6+d+܇kW6q v #CS Õvմ$ނvC؍ ɕk#uc~MěwQj#فg,Ұh0Mc!MˑEzcE Ng՚P}xV54$ oM`ƕܑT[&!Fi>rppa%AZ5 ] {-F*4:1ܕJ,h6Y@1@cA26d`=v!ay`{pBi p ;`osb+R$Djٍ jOy^nbrsQ`)1tD~9&^U ^X\Pd~hqXws_D L5 p=a$ eRը;euצ65<<29^ |izi:Dtix[L<Pb)Z׾Z/v ]U_p嫚:+sCn}yTA qTOBZ7ԆO著MT72̕zu/$(–)݂g-srSUY`4 ϑԥ]H`0]zS1pΎj8`ҝq!xޡh:H{fU)f4%а?Ɏg'Zs\f!CL)oFkX4y*:Ł؞uX`l8$≰bt،qRaeL8GI;$gVBCWUjcӤOMC x 럔.گ9-Lmʎ~bQ\zܡAJ^i v晥\_2K\4Iԏ#s$d\dPGj=iqKgE(@Ev~lzne ܮ$,mJ+Ͼq$AF2ۯvw%)ĒXELcݱ$ cH\VnOۮiX۳AVZl|\ěMhKN\+A QuܥMU[͞HK? >1Ũ֙,Yu▏XD\F2G=p[Tx э:^W^8U ( *Lt[;W]|Om6T ;KlnO36 Hځdq'z]A`ckl3Bͼeifh&UY֘1#g<.l2 j+/TK-r i7Wi`U6*aDkqRյ>snPnӍ{]sRܡR lD fAW& oh[ /:V\dO7B=q mfm;rmdgI1Q2NDP(+uxw)sz !=Rbm\c_/ӰFk{=&L!QNOg5]X%"Lͳ+-T@%d3ah , _xY>qRn]S -$FB+SF{|`Z%l{)F?Q'5FG #hqnߴDMʭkUIL~l2 ͣ|[ 3dMMC? ~0qJvuO Ѥ҃";3^BRʅ3DHI *MHIqv7E쉾NeZ5*o\@>F#Gj4/cc5`Foi..l ~+Q6N CaKW~QпuJ=Q0bo[}mh܎|ժ]WܺrbIq`5(|+ Pɺ%hlIdקZ8m]eXq_ڑ7M7^ˤ)4WrWڄ4EJSfj{ԙnlLşz]^J}FԁlԶqvNH!A8<Qn^Ѝq$h(ΜX0 |,ݸRd{J6՜Gvĉk,p+y` &ؘ2bhM?Tnn\RkxЛYDCE͈Ѫٕ;}?'˾f1醫:Ԩ3^BS:-ٵ{>oυ^4kz\,|RwK+3802w<[l;~M`tjy7{t€2#(s5<Ԓ1dwX΍Z5_d.g+#"t"&c7^y9jҠ#tFJGߩm9Y9sAx=¾ 6FQ>x0h6N*wҲ4xZkk#~R5 vo1ʞ,-JJ NAۣnZ#ZT(I 7Nj/Ł&B~TvF^; E2#M&7:phqyhYs[hMʉ('IaxPFTDw8$ H<*˓CQFz5d4/h >g@"b'h d1ك5ԫ2/|t~~#!dm}2%12hLO r)G+<9X()44觬h`'+8Uk?鼵/ $yɷ׏z$SIsADx09e)!y(ce7LpmN`_|(z^ݮ>.@ëzqiy1d^~tp.dبqqjղ~? U# AKR2'{^bj&YgYX|@ D6Pmbfݰ?w~ kqOs!EP* GIR ̥;8wϠ]z-A[t to*w?ST yO&-~{J$zcfqs&S13̀pO!C=dD>.J'ũa.q"3Js;N({š@ 8é`Y{QFrM i~<|j6`;E E5A?a,}Զ!!J7@R:jA/ӛ{0]oXіEkFZYbLv<"Nosr;b7c> E0AWL0ߢS$\;op ^f{o^&(w ɀF4 |LaaF7I dbd( 965'wSe3PAGͥm!/Z Xt6M`7h `tk`[Yf"BJW/1 *#yLrk7*0)_YJ;, =yeĤt~AF D_< 0#'#*=OZ(3fDR]u9t7|L "2GWv@nb,GZs:B7ЩrY endstream endobj 62 0 obj <>/MediaBox[0 0 595.2 842.4]/Parent 960 0 R/Resources<>/Font<>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI]>>/Rotate 0/StructParents 70/Tabs/S/Type/Page>> endobj 63 0 obj <>stream xrۺ3>&.$68s:LڸӇymQ#_,@a @; Mᶋޱ<}yY|]m/N_n6jz~qvX6rMg󻳳GeQ?6+ ) ͏ly|t~q|tePŗ#GQ4YӶoz̻OMvs2γOfw7W{}^ד&or=be>>zhOd[,(% *qbŢ)lͧ\Ns&|* ^y5YdK?u9yL7UmVtnafu۸z2aG@Z9KJ#Ϋ~=(ڢUύEUqmߋϘj@T] ]C*{Uv+f-ZޮVS-O|& d9} S{$ B|35HN?™}x<}?[drMԽ,<5v~#jfl[gNs 86->ZcD/O% i߈U;|@ZvE͚f!惯|u U5 N/oyP*/"A-xP@qPb)dlGDQF)ܱ#B ["!uGΝ zEu~EYƸ?똅E\PU|sM$`Ǯ]@nfX JU~ eCg?>+u23nueU;-1EzSV!}i{hʔ]Iul]`/9ޝwg=Kӗ6”ua;8B _itX c^I-_- bK UEB2/\ oi28IuU֫L/)RtmA ~}6J6(cwHՅ*iL1[$: ǥkn\!**c&F-#a[-&, 5jWʺI$l1V&H\3XxaFӊ=sSŰ%+?4ݢ:0ۉ, %%Θb/n]Rd:Im{B,AÈP񒇐#{/LY.vdLd +Onܝ0UB".IV1K}J@$NjZHG]jOUL2[HA)8D1=nL5:3qIfgQgtKS7 #R|w^∇H~#^~|ffK>%I/Uuɬ1Qrqi" %F-L~$~Z0,DhaJtPwKU$wo:Xn$3kHiTލzZ*qh(:9 yɿ Cl-ѭKE%vZw` %|DWnwo+BVYe6ֿ?W!J[ǫS4];HMs})#/B_)}վ0\uL5U +|'4}?ZX ":uPP o\̊EX}uѢkQY%)M ?='龉V[n ~}l4k492 O㍄0U/" endstream endobj 64 0 obj <>/MediaBox[0 0 595.2 842.4]/Parent 960 0 R/Resources<>/Font<>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI]/XObject<>>>/Rotate 0/StructParents 71/Tabs/S/Type/Page>> endobj 65 0 obj <>stream xXo6~7Q-qmht1Ї;s wG:PkSɭK<~Tv,>Mg 9:*6t!Wdu||6ղ|nP{=UEFcpǟsN7L%d]~#`4SAsdi8ɉ b%)g-]d~ ) gYjOҽ W;jmvNd'42B?ɟ ?t4p9bP1 >DXTRgT jeG.F㽡g_Q wlz= lF$C׽HJCo̻_p{zluZ|p5e1H!.@cRԕѪiVtj~ib$Z09H2LfW2¤TL$-KBHq9;?cLxn^g#c_Xig yfrA9hi5& ))Nv6sGʕ< =ϠS K=.~p[)S|0Svjݺ mӜ*˗w2Ε9V:3P "֭9o ƮR#kAԅ$m{8C)d=t;$ЍLհXr &>8Fh8EQE4SpU04mPL,S.m <#,b*#xFAWocOZFyRahaH_u@~0P`(,vp,f 7yi{MPe 6ïu3ƐXm endstream endobj 66 0 obj <>/Font<>>>/Subtype/Form/Type/XObject>>stream xYn7}nP3Krx-( ]!nr}ϐܕJ 8Kr !#9ID'N/ƣџQ#`k~d$ZGu ^N\^GJ4S" B+/|H:1O4E^jKԿ˟ƣszwj&M6Nh+)-y<:I -9^ȹe1Cx6 NmLEQVa[:C$ɫm(؜J<1WCƆ J|FX'rR}+e]q' kx LKE7pP%s@ 怶Ea5 -23wž›Bu;eB碸}A c^Gg&жN[jN[oag;6RҔ9KfE{8 YW@pƒXVm[Mžlli-ʎ-k>\x./*1Ĵ?C)nZ B EO_m[^lVV -25:m92}2̥y!+.U6:i8F0-/=hy!WR^j[tCv*r,K<4{knzQxk9o2 sE,o ~C-jaSQ$P VFXIf FL5GnHE2-3 j fRKT\PŃTcd4) 8ۣtAGQk7A G=}u6J+g1aqch_^pe.^66e#*E:`WE:.6fmn@0ljX\,1}`/ G-0z-^9o/1wio|uUm'[}\̄!:ZO 7.HNJec{uV{ŶN֡Z sʷ|aKo>FE>cTFkt^OgXڣfߜwBل3q;ua5Yyd=zuϬP+WC$%zj;?5+p^jPcݴRy_#,vf%& " }t>gɽ p endstream endobj 67 0 obj <>stream h246R0Pw/M,Hw(q.I,IONT030 m endstream endobj 68 0 obj <>/MediaBox[0 0 595.2 842.4]/Parent 960 0 R/Resources<>/Font<>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI]>>/Rotate 0/StructParents 73/Tabs/S/Type/Page>> endobj 69 0 obj <>stream xn=@AVQӼt0쭧yXqmvEpIQ7%67΅3x[]իɏ|q>Mfv98^f=9AOn:޼:=_U:%YUpRdwӓ}OOf'w,HͮNOI3YYׄlYy^f(Rz(f?==9Z#˥.G-\C>>glǂh=C.WtconzW 5h@:nWyF\ͬ?"/a]Rq.I|jRW_ Imzy;sӤFRDLBTl2`W6iyi]3A2+Q!qZBl4@rAXז1[)\62o2:eFY >S޶0Jf9Hr6FW%`cS"K {E)³2e1.jerB w@QN9g1-W)u]. SC&`0KA" ;Ҭu_?w BPHG>pėC_÷QDK{hlcdO.X@#},"4["\ZsӼ=0ǿ8˔Cp{5ew\l a'G7ő cKM6 7Fnx&Գ~5©wJVu"h f/Ȕ+ڦ1Kiq ښ Q7/ [E96H~Q%\u ..R$"U3WO}N pæ=BiP+Vm{NbkU8v Mp(B{y[E`#m%)>#lHhlR0@`)1X(T_);Eexe⍙wEP"˙G(NfSS$oق-Jެĺxɳf Ua$peZ7!j4FkyFA} Q~hFҊ*֐Ƞɘn2JW>3C=rcQհN\[lDH-j\/R  7Q'W #<-.OJ$NnS1]=>Z ϽEY-˚,C]tc/.)Sg endstream endobj 70 0 obj <>/ExtGState<>/Font<>/XObject<>>>/Rotate 0/StructParents 75/Tabs/S/Type/Page>> endobj 71 0 obj <>stream HSMo1ﯘc~dW*/"84MmIwa!=oJRn=7>9;Y7Y+f}u!AgK(!VUr"9ILo+m%hI];:o8b"KBL (~H^ p/UX-`Y7c>}O2o}YnS=ziUO}/Q!. FPeЅ–Yu{m69ە6iSeL~j^kZ9&u-Xo6W\jSJ%ŤQ(\ݗALA9זG|k:QHjK@/KI|[>Wm0V:>stream HUMo@W+qJA8$=: m|c\6x& K؁M"Yîʷ!lᗱ‚Q!\;kFO+S &[Tѽ&_ЋRWm [˜ׄ9x}875 }׉S"s1dh6B0ُju MVK K4Z%+S{ץ8){AcyV|,Nb[Sm66\xa7Dvݒ/}:NtB+ 4V{ҕL(kq*iqƂ"JnOvy,E؄PlZsѰ̈S+%e `p2g]+cqNf ٔvd|hƽ>stream H|TMw@ +t~1|vJ+i@/^Ia&ib{PIYTQpk.)ݻBIFQ}pUo5mG<~8ypZV+rH?fBJ@=2nM_T \]Zk*U$uEOޭy4MOn~N-!i(9%lݯa刺Z&+LeY8r .VB ;Rp,/e7O#2p[y b`ITkd>  2F}^ά{XhGF0ec9Ҽqlَ:jK͹.4AEH(V?|"Ag$hdMhWUfV&S~ 9b@}b?t!!ylyB@AZi]m"2)B'NҡFyɆ3ffaiވA[vO6|WUT؊w񮻋7@.l7 endstream endobj 74 0 obj <>stream HUMo0 W( a; |3zH4MH3ؿ$Iֵ$D>Rmu7``3gy t՗YmV}d]Qe] f[C9{qKp0aw"ȹ2+h ̕jNe ea:98ؔ8ye"#LehLQuGi)2 }J?2[oh$c܅TA[>YSN®#|& <鏶 b E'4EzOo.;R."+KT6(zZN0\7RzfqRS/7}t0!sJvAUP⾉BƦkP9jaAV>IJ?Bm+h|]8I 2QNh3a|Lp6lCESq1UjY8(Q$f,Y.ͥfBK~Ϸ_n puiu.ipN>xJNL['~UHgw2爪wtѦ`> O)׍7 >0/ endstream endobj 75 0 obj <>stream HTn0+("ɏ@CR@9f EC}PZy"pvg,Ayer4vs)1Ĉ l2[3[@elXqTp9$'\8Hk6!A( hc2ix` Z>)$+Z5]<(rDFp{ZQiێs-hGe% OPT/C5f/ryIk*LiاCFt4_7g7?f4æXQY7MŞiƂ\bQA܏9 }m]eHF4 ҇_F*v6c'ub6I!]҅B|bqC/0 /+x5vrt$Yg41w.pD%eBrB嗀PƔnl("2)S9sR^h&]^RkZkCd{NC7~l'uxfS=G[8NoI$L9a/%4AtPy&:9(88+e+-h /d/Th^ٽ7Mq\>stream H|UMO0ﯘc,!K`%PW@`mjGNw<3:іK7IUYgAݮKY [W _אu8I<#[Y ӻ5K ?U.In#C},+~-o SGx _v@K)н{!劾Z mҲ`LC7+X|'۫k(pyw{T&*d4`~Fu 4 Bq̤ bG W Q9e&ZIa)5ã}2[٣/TEh& %e]A-^Cl'+"#)5)9EzȆ%ք)SMq^,d| zsà6XWg@twǪaҟ8o9[C  |䄕Q"EΤԯGF=gFWqk.ݽKᬋ$dGvF杙柫gLLWAO`o_#",ڏ\K;LS dI6|Fdp~>؉/|"&F^zl<,uSOy{ endstream endobj 77 0 obj <>stream H|Tn@+#u@)RE!5R:+ļZ!n}ԍ=3}Ι)4I`u),ɡE؛~EE'ofdâvƎ 6:ZK8Py)"Vm?30vuoD5NUc墳K\ 7BT_"dɄz<"7;喩ACZ-~GS~~nnЊ/av䣱-ciO?z.сI[WLwK1&CҤW9%`jذA68 6j<57!|>}u>AwVctn_*>`$g06)`hk'aDhm;E7'Þ.HŊS4Ǖ]1HᎦ^t{,5-͕2y#\U ?Xxy5E;R<61Q-Ԣz):WIҔ;FgQVױBUxx0/ݡkD%u2Q| hOP{!xYBޑG뿮ިc-ykm[iFs2]o00Ւ7! `Y{ endstream endobj 78 0 obj <>stream H|Rj1|ẈD+;KI!R )L(㻒@^Vht\X[py_3!o1!88pxxqS&SvJ@H5ֺ,G*t) eTPGC Jk1C^*ʷԘоyss?cTm8Q+B.ןb WJ;GnxMu\L\*fb) \,d}tNvy {ʨyNbS5/xᎽQyݑ;!/*Izhs-<j[kBZbf.`)y9t-J03l5-Կv3Retđij?kQ^Y=~#YQ,6X~ E.DuVU\ `J endstream endobj 79 0 obj <>stream qcUtGh8\*QE endstream endobj 80 0 obj <>stream H\T P힞n0ifE5 2"k ~"* ȄZkT4~]WEW5]e+ ( 3( 'j6b xg+y#&[=y iY b F4YG˓dOcʯ?rװ7}b %u͕֖Kq"c|cd\ EJoJܒ\_*m r`J9ܒR~ST.Dh [RqID*-ٜ_Zo( ~gN\Zzyqn( ʝ<ݩ ʗfє ` I*ʧ(EAA%R)TNߣCLBw)|V|Ɍc$$s[9G)˲*[ώp~Mp;64.xܞqO70x|Tl U3Tq?fyj5U rW}Aj`ţzg1׳;!TXYd/wVabAxshVcN*{Ùn[JZ_YwBjJT0\#8BR@<+T4/L e= Z! V`51p H~P,c&o%5mۛkv*]*t;;5n4 QPd"Nc`h(°xJk65l>*RMCA_=%xcsԂ=-@ɨ ׯC 02i_x!RP(ՓHo8/pzM!V]el1jbs= J[ee0v&N=@ c~-) hI~Nݗ#VDGisA<%~mw#ђh:;+\=)jmm۲Ǥ &h\ţb0$b :Ft֧ Bi7SƴP-쀩`E(mdb9[ jp*]DW6{9ݑڒڧuݻ²Tuͷ8iGaڗ$ytz>YEeeEl:F2;/@y #+.]n l&0&> 'l8?lbF M_nru[ wC&c(AΑ<5%$$aiHhξZǠ0dfqWu_i#h5~K=nK KI׋ʩύ=fM}`g<'a66q̔=/ԁ{@p9e,,-mPmak#b-ѡ8;j*{i?#Pau^N WfLftۢr *T v`@^dxz,o|#w `zhbd +6}8\-ڕ4^{NX~uwŝ잝3|3"T"9yS׏4:~,.w$w(*Q%@+XQVP|vY_ԪYZi+j*h"~]i-Aq]S]*~6bF4EI5ff&νs枹wv%pQ ͻuS eԪSܔiS!òto*\dr^ex9L$iV PMWR=s {|num:%LUqOFꪃŕ|b%vs~_6Co|f3Ba%S{PN7<;Nr^%!8Ƣ$0\\xH rCVxp:*( RGy  vBESF56>Y7wޖ%_DS{svC xEKՌ9`\c Z8<80ZK2#YG}5ބ]ZSulQTLnmkW̱K{p6qd q]^*xc UK&!X6a:`c*>EŬml@h ^iCv Qz࡟pz:|p}XkubV!en^SV$pI)S;je칷#AdIf CZ6)-MՉw*w+@(nJu0_kO25f2f;U0vRݖMlxbai:Vq dib%_3흂=O¨Qv=b#J?8e32vlV9)B਌(}N)bTո/:'ɤ՗f9~m䤨3WԘ_p q[H֍rϲ'v'Zȓ&nLmC@'@?}  ~R @+m JLS̴ӛ*(7]"K7hJTmzZhxƲnRWbL Hq"VKi:>uC<)kgHn]ZFnfEt@$>δo,tf;2ߠfmK\b! 6LV]9o72\"|^l-yBI} c0k0Yɩ:n~L\?A.gUލ3'g"C|uJzU6)Ы^l3dCnZ5A!ff1]< y)ewe0707Q"}~fn (gr>YŲg$] eH,`"@t(R(A||sKLvܖ97 [#;qe%D".4UqEtV>LT@&>pH3i5)9z\l8uhOXP`;,rh$dE ;GL2wQjb1z@ ZGP-6ZM# /5(i Ҳ~Y&%a6koI1 '2E/ׄ JyfyX>Ofk=CDw endstream endobj 81 0 obj <>stream H\j@E^&WuU x13 KmGKB20[GH}9Wr}7440S׷S ]kfZK=&i\|_p!*7twv8$1a{=>stream H\RmhU~ߤ-h}Ӆ4]s~uj7enkMiJA&o`7$1Yt$Xt T&*2! :S_ Ǻ`sԛx{=>y9RcSTU5 ?:X,jvbE[)JMTv~E٭ȥKq%|jzl=qYϨQ?c/Dٵ \gNjtG HkQ9^K;qRC#}duWdћQ_s]_v胲_#t;uzW0?ocExhP-Ԇ¹ךX̡CA5vD+ZoDW_͢Eû=P+:􉒈+ .aOq4QKgxd]nA Fm'&0*D-aVZioK8%Iۅᰗ}֠a;¡|k@J -|\~}v{hکMS ^]~t SM˛1e'7M2>t6}%\VdbXc60V!ZHq523gJN!mՎ=ZBCIA IRh3<.o /#_o9s fdZ̖Tf1HRlG?MiӚV"5^9J4PlQP[ w.QWt; 7Ok1Y endstream endobj 83 0 obj <>stream H\j0 ~ Cq6(i 9t1{OK3gY=u&4ރFfȷ`rBCQ(S 3Nfp-[0j ?8AY"Ԇ6U|a4 NZwC2Z%+R3.ɺ^A-gww{"q|H|`>&>2W+s3%TE_p"?gHC {/Y|aGx_): endstream endobj 84 0 obj <>stream HUyPTG}_?&dCf@h5-(x9t0 #x}!1Wh9)ݔnؘhXfW&(xT488=Z{~ cz>sE̼ sUejm߽  ̼Y_-t`F5@1ؚlD }IcONmh_rs33envs^|k|쌼o [n˟[ { 0QbM0;UCǫX[[Vt$I2k:"Qi.NiRg r{5Z?>sp(Ahy<= kh;>bVVJX%rV([TIབྷطb7WhwH;>@`PǗWKfKAϚ5?{p::[.M l4TK9!-ؔ=jދO| 'x @ JU.lv*̩vP5u؆MZQR/W&g HOؤj6PЪcmشxcq7l 6lMYl4sz lңfG lj^+ kv}~@,0G?Mcc|KjKӳ6O,r.`CGnx<67-/+Ϊ;+į:kY&`k{ksYj;.hnPAOC@5xVpG}ݾvgZړӕFxdWW]c.=QԫO\\4b~z]k^?7  (`PzBÕ(.. ~zBh5<᯽8r(fm7 ;{:ߺX,UJ^l'0/ +# w=q_g_Ux##Xb!q Ix x"s`%6ŧ as|/% dk|-%Vc;W 7^kZz^ku:z^b^/7? >C0>\ʞ|G| c8> ~ y"O$Sx*O|>B^ħb^"@&<5 )Z+"JD_?~ h"P  ?ΪbU/GU >RyH T`5D UpA}~@KhFjƨ85VSU`z0S%jJV)*-X, =Pߪ UUST*PHj*UTyjP "D-SJZQImQکvj:7& vMf'rD ;C{@w tNB7>~1 !0pf,J`:̄R(r"X`9 Vz`3̅Hib'Ƌ)"C "_LE"^1U$B*sd̕r̐S'd̖SEb)RD$(( D-ƈ88G p N8  p #{aCpq8'\Kpu76܁cxsx5#&Y8̱HB&곆1kškڲ̺n;bYO֋f,E6F)ڬ* x~!ȕr\%r\#+Z@ zƚ=Q.bQ.RY.[rU_LΦx&Я(vAf(vQ&^J}B)Pt:Dt2eQʦcC)Nd:ISiʧ34RB:OEtQ1]D2͠+4R)]YtnPݤt6͡;4VͧTAh=cZLOh URzJ-紂^JzI״ZzKi}AKD_f5mi+m m-}J :QiOs-t MZjëkv:BG(ctHԵBšP~(/43TGz8=VuNIzN):U tՓuSuugR]gr=W~'I~i~gY~4a3܈0CFe'7|&ͤ&diJMyji;N6ΎmfN?VŸޅxWk0&D25M-S1uM=S40 ٸ~?%t?/gel̲7ML69J;Sffr35|Saye^7歍6ƆlM[ֶul]v]m7e6. {>}fvN\q!7%D%n[斻#杻⎺[{tO(,ㄳXֺ}WrC'FKRBBA7N(!HqD㈀32`a3i={Ɯ59g{@3Ŕ Z'nh=Lu(ctn;BD7uf:Nnu7ətf9\g3יw~l ha L=Kֹze[Mv{8F׌7LY`@7Mus;MWp=7Cs\k@wa=_p}ly2"75\r[{/X,O > > > > |jX0+ ʅBԉ:I't+Zmun:CwԝttnY_/bxWL߰-L[md)xS.=l5>6#L`{|fs/L|E!-baaWMS^}c_~Bbappp8X8D*8L7EaEU!{:/j&8JѢ6up[fL2cCN%pD("phE$~(#-bDh$&k a4 g068a3L-0$sG>0 `*i{a&Yfȅ0\8 ̇Bȃ a!b1X awX_Jp |SfRIX8i;Ҏ;ne<[,W4P|K W*\+s5D[i }Nis]:܀vEn -9[p2'r*}EtNir3gp&]}G܇so}'o6 ~KMn+bf\r6Y<p~{ȯv"-V2ZE+h GscM7TDTBGR)ϣy$x qt}zL='gA9}Fi-|Zkqimt:2|=Vܚ.:O|},ƒ?.ܕq]_g]ue~HW ݦ_;_+ e2FFl"wȝHm8oZes+` VКjjHPPkLdHYϭKO( @ȿ (`42UVl#tNd6ˎ̔e̖]dWkٵU],Ze )DA3&PgD'} :ʞ&{eP;hٕv]ͮnאdts*#PEXRѫ'x/s7P+P6e 1HRihਪ+~n6lݷ[ tf?H|l |j`Z)P>mp7AـhZ;-3Ҏc;vMF9sx'U)-JXiSRU!ţ+c<'=<̓y==/Z5wU(? jo<* N{gGe=޷eP:~:p6*j(rU9!DmG*DWNɻP'ȇQ->/f|]' ieԌChP?|U䈯7ZrQ(vENQ]^}]Q4ߤ2CTt)RCQLD^Rm,cSb*.MnpJ*%(Y1<-EnprvɺM>ܝuOfJ}lD̶;8o=ClrA=8!FfiJȖ=>h%Z0=Bkq^luH&z,^'Mlz<oӓ-d3}¬zSnkJ6ڎy~vސ1ۅ=K?ĺxMC ~:5e{LoҋtNK" dH>/"#&Dc+ zRH\fhZVyV]Gdq{D c_Qf7ҏ7*.t 0-Gcz@1 PtbBM4͠,hJn굈a]HaA/tI`EbZE"0+\!=4jd(V li9Y{ ~)0 [4ʄ-mL۴tbuz|qtJ#(Ա9z~5B`z8tk, 1GkO W>sHi)qXHyR92D\7 1%rXc$"Xr; -{9}F`3CHdbj?f~4>S7L>K͹bD M+NͰv-%X>M!W(9 NMpw ~o|rȖ@'kfishpS:r}6ْعl0# >vtS <6k1m]z[G!f;Jp|1Cgl!hV/|m&n͋uW*՟&{/e5- fL~gC}IX{5NuͭESL6ٗJHlh>EJoO]F*4S7&u7ÔӺ#tn"mK1flX 1j(9q[D()%|"#yLDfank1PlX`^’vmN K~$$VKOp:J[ )-hR4lv 8#%AuBXi&ɱd\ƳAO1^I/h zk&s(3A3VqKL qi%sͬBoB/RaK3%L6?tS11vAd5;7enQb5Xy~nb-O "LĹceք}7VV 9 Ј>|Sk- 0:>1lfԢg5MG Ly/{rF]`1i%'t1Z#]¥ZԜxX@EυAܜG4-7SnVjR@}= WLG:8:RĬ*_D`E -W"82Q~|:Jfj:5;xUuq;{\ *APjV$%UH&qH ib35 v:mm::t)S1 6S93Ƿ=gwG7T}>{;e Xd)B`Exs to86zUmpCAXItm.FʤFBྈ5b xTZ$@2!0q"Vv9L#.+½- ؤ@#ġiovU5!1`Q'RFk٬7 <4$΅@b:宆jWRS剪D'N#yQHA94D2j N \}ul}1cW, ~z܍-"nt[ϕ#Fsq[k$4D^J8|>*::yKJ(Knu5,BUc aHhh5=l)¥l)J~^B//eQ|YY|!Lq;rUm% :V/pRg^T\%/f/y\?/ěl^  {=Ƴ4Zq$:$QafIKXVe2sX0&}˳We G=9L~~ /!weZB\xTkS"*]2m:춴JI9F̍#DuUX&fؙb,\X%|VY-13vXt#>:k"mEwi]kuUM^06:2bF5/z&H2 G;j|$#x6BݪANEвE͠`9f`hyb*3 drP?'Ѯl8?uxUK6  J%WQSi)J/iETiP[RLoGv|i]r{ShNP2bT΁} ͠bU'9  ?$M)mtr+xZ`V QIeTlbϫ ";e<>Nz_l~{N*K;DA$<'MԃSc<۞}mz˩Qt`(ERC ʂ :;'}36Rli¯PV0rSQ|r*׍=5*~ῢj}G1dhxiK1gԣozҞ1z]x)&Uwqػcb܃ m1ko`3 4_I遵N :=]%*wMRvN:EISX@6iW~Hyb ؿ6JLw(uc>"Ln/{m϶MI>Ki!EvOh;;F Z6>;j#mw;co <݅OE  ï;8m hI|+H=twkX)qkUt\ć\Ksx< [v?B{kHg2,̯Ψs455!n-1Z6mf;R;K]I.`r/g`^g3$# #YJ~8=J%>)wlԟ;ޥMWV>X.r@!q}g6 S,Ty\ƽe6w~~c$1뱰yFjQއ@;26CgdenI" NOxAZ9f`}"I΂]V˟G"f{sc3xQ_Bh7Ju7Biv[u)L {=SN 4\~迚u5{Ő yl5 '(Q+{ȩ*ixj4fi;^]K*,s,sC3Yws,FI='̃8|o{PY(N"$(;00aP 6d , [ bJ KbQB$!T)Ae )o#VWv{9?FRðtfkNq7;Ur@1Ycg@^3A r[虆7|Ke=u+>.٣e\Fu-dK9_CTqv;MCw&1L$$ʺtiPMga;5͒ =0n 03u!(0dOLM/[A.K7T^m7UG} Qj4?A(b~JSҋ^vf ԍNgʈe D#;^agK${ _dhyD|2ʫ%s`=TNǸ:H6%: |6~Ga>Ԅiغ(*K%$*/i1&1݅r΄yUDJ_o^x=MzNՍN/WpR/M4Th|ZQRW52X⍫%7ws@ycQݱۡ.j#WT>]*B]XŹfMQ9[0 k!)7) rT̟I5[ьcTx(M=@V}v^wo*f7gsaG{ 7#~$u^}^r[WC eT骆P ҡ*CElP$KB~Ŝ5{xLaV Tcj/V͘_w uXͤŔ5ab69apUkiY?Gv5cVs$s>ڛCBBib˱{ר/6{uahe:-q:MDw缴\6|)=7ILPHl-%7؈!Re9쟛ż9 ZXV7C-{X]XM=H=Ɵ>7F W'V,[IU-_Mh=uz=ޣNtj!?9)ͨ) :}s?dro裎gǾ98n$dœf~32օ}$>ๅ\ I!zŲij1qZX:_cS@sM:r|@gE3d7nH3S?^ϮQu{TZ\`!k9LK~E3RhPz3Fsg5hHIye>?.jXRӞEmy8،Nٽθ؋ĴC{Jϼjc wzp5h^DlVWail(cgKhQYUk`mPaWx]{ A>ڵnk̑ͽMJLGa3ٳxFm79,c't6u8wd 2Ikiofxۥ,&qǥ>틶%w7琅Q&mRl|Lj̷AD=PFu)p!LDԆ:ў,*g[ UQ;ae=C=GOkcG(\mg=8oC>("~_VF| ww}5+דa:z>֒˷-}su?npIMR|x)X_ AYB0,Pd-A Hd) 4BlHC%F` 8-˄6E5NQa25R`*{˼,87ι_2s}cۿybmƠmA A oؕdUȔQ{g$t6pqH)Ff7$Sk!*dm>Ex KPWoqٯ;=LEV=:kU'|[Tlb_([3/w}ZʾMl7_Ӭ0Wa3WHbyIuOH7o~Lg0!}q|SiHpK>9&q<}y|byf8< tirHir}!d}^ƩAχc K5/@k!,\0'p#5>\9bzo;죔[w _/g]R_'MʹۇgvāGyĿ#G8چ#x{.wAM$DB,A:SYuҴG<~ p&[Ar6&>Qf1>Y)w$<LRc!zr*,Y`硜z > s;vCoAppfY%._b5}N{nƱv`#sV˪ gdXlFIVk )c@h=IYAe]Q%Hy c]s(?QO7ǐbpce SX[K͵ߋlmlmKE6Gk>'!p=& ܭ|e5N^^r_cǐ۶Xԣuc6} I"$k]S7})[A7_5@ֱIn~vW{+njWsxbl,c<頲Z:>ӥKL^x/P4RG?WUWȧoQS_ST%oۏ W O-u_Pl.تnu~)~U3]@?^5yV_Bqְn+/b;.j`ϽzS\;?T_\.qzɯ>6Ըif\wܭW̕sdFK}C 2#x~I]yhnk6p[GW`*l99iWe c[br>-{h DꚙꟉ?s0ޒ;-qA˴Ǝw4生j\obz4:iOĖc}8. ?awi!㧈_'&+}  B|?"G]%_c+-L !#v.Jz ܥq@Exl]|=KdYQrw<#xqB.a $m^R=g_HT='^A'Dzgg9r!BA]%䜚2(PNJW[ƜgU2>A{0,Ot1sIlΉT3"/e5Lfz2%zc$MYn{mFThӪm Em㛅[{E Ll-=-u wHsPNKϻyelf%sӏ=ӂ=ƌYE,}mq>nzTesVp-+:G^Dm *ieҖ<  _W: ss3 d3E3avAǷ/h/ѓJL8aOot |U*}Josx} u)K#d5Y*!7Hh9j+U}~̵X#tDr5XrݼIWxkds/̹D 7pPlҨHvą>6|t$ۍ<)S7Gi}5z}cu&sZ'8YgR^7TlkLCrno q;.dl<1aΊG@ﱛfWh^&UUg] 4TaߒHX"K # *KKZEjAX,%Kgdi{Q缳gՆA5^=^O7Mof\Z#i,,*&>= l`ȭ9Ƚe}?B܉ۮk (M:<ṣz|k|Wʹz_ א5oS~ϥ+o?n@y#Q]G n|_^ ᗰA3I5%^jVki|GSr{?BL.uHM>hR5FmܽU4PН݉OwvgG5zGhm u =739HYa|&s}&^4;z/O]ʻ˘a/I}e3;HOMɏ9+%fMܹl:{;$WyYlҚxV}78qxN3bj/9q0v>̚}ط:!ǩ? 0'Rd tM'_zmԯF3]{#֏MX+#8E*4moqI֩^VZsм&=kZ-e֯w5+$o]̝~vn nKz^O RdO?Ir^2wInxvmZv0eO5.:5H 87wM=i7ZR\t ]pVs/梯s Y (T(oDGcH?tsuzҗ|=yU:{ r[*0eD7jO-Rrcs>+]xK@ϼ)OV7&cbme,B2xvŁtBv1RX^ԌRo$3tT3Q2t^I _2WXW?`l$l+Yw%>rrV<hh*o_֢|Yĝha0x* (ceCT2mU;e#)nnE!Y N4dY]H}CfT$xHd>@"YaH+q&v<Űֆcw-_g˞{T>ʊ6!Z^U˝c^6Sa Weuh&K ]T)2؜!9 2мɓwXJ9vKud;0~ J3 @,tA[ݯ/g`@,̅0zj C0XMȄ Է_BL}{ej;^qp*%뿩yϳu>q;u;wY}:;d}g&|/=y͓PgPN` 7o;Nģ u;hUYbx~3_0O= lOku?=owjDA4<@ CI $b^$!Q"T("$ʣ0MZ:)ieڠUgZڂ {vM6a/&|r~wPjP<g+ވeiz\SHo!"VZ}Z&^FF~_u[:~y3tߑo9aٟ}^,nC25&z&BhRxڑu}ҽ!1[Ho~ǜ"F+P֢ ];p [=dw礊,BMx; {;kuZ|iH:;ma+FqLளF,⾔N'\GYM#QI$TBVQd9g"EnjGF9r-/w) {1\=0Ӗ[vX;vb'>7p݈*xڮay] ޭI={GwGB#}Pi % *2aN@{YW vRN6QujtWah_j_o{j!]nhڧҮ8;o[}nNۅ>3sd]sQB>l h/jUNMT/]yTO/ A-|"cTb`1u]3f_Q1g]Xmh vi|m4zbk׷FߡWg6sePP[]WkTz } .%P8O# 0`8?AE/vD(Hq}?T#`z}o#}A&,Ve~S[<`JC?5q+ _TD3_UP5'M硏 *u cI:ݭOzTϦŒ1s=->y$^]bh{?ݍt؄e xRO D:e<Ӓ7=KFFqh@,w\"~hלw9*oG#`ܳH^G]N\+ȑAZXT`섿P2Q1w'V00 9 B. 3a |XK ):%)1JGx)5P~1[k`Wg12@#Zȥ?wT^Ee^jݰsFods=K̶'$i{vƞNv4淴^lnvͲj3 :s;SiPU*?sgXSZ{[hsNr>})P\|s'~fqtZ{L+5csǑe%2^"$ܿZ|7Clý8UD3ck c{?c5{^e_5;z!4|5ҡU(P |dk/om.>ݒ(Q2C 8T*.b3r:*!Tu訁2k5KQyL~n~ }{qy_|DkqOsw>x'^{y@;~/FK5pG\wf7*1vgHlB:*2~ƻ:Z#En1nR3eRq=\BC0.æ*1]VAKBʗPw+M5Q>ٹ(+Ư U4M7i8J}1c1c1c1c1c1c1c1c1c1c1c1c1c]F)1zk}(L:u$HsO($k)^_H.qV"y*6(تbx-ćTThi|bYu@y,[U6KO(M=DVr2Jo1J!ZF#QNK?f*PWʐJ-E[)h1aj7l~͝q)rHa9ڬF-< iɍm1o1cv:r(g<0<{gB $9zI!:9IdBMW]`gJQT.ޕ^oqk]:VmPHJ4(sBrS#ao6XU r.4r-Y1430FFV}<3곂̬nUU{7>#J_bdY8j_eFRC_F|厙r|n`2iw+?9rLpqK%_:p rs  pppppppU}OBꝲ\: WWTRƲ^<rʵN2weWonr-Ue%ŔEZJ e>%FR"yjJRE)RN)RLJ⧔P|9ٔYb4TdJ2R@HɧLQr)(9lJ%222AIQFQFRFPSQRPSQRPSQRPzSzQzRR)=()(])]()()()(m)m(%LI$RZQZR(-(/C9ҜGiF9r&) 1! ( ()(nDN+ϔ(?R~|O-ה(_R|N)ǔ(R>Oy.۔(oRޠN9Ayrrrrrrrr*˔(/R^fڪ_N>?_/aKoo(oM/~R_ ͽR엽ӿeߴbEbyg*ř~vZOw7/9;3}G6^4.x^u;N݆*^g!% {zϱ~֎gЉ9'Y ֏~ =]=lOSmA}ݏ淲߂{d$.IM%iu6NwvmzzЁn S[ M7`-ǚ uZ\=WSWgX_ \2u)Ϻg]L"\ p>ùw[U+ujEM-Qg֪%VuSKL^^zl" ee^= |od.5KC^FedkWFF&X%i)/d{2,:8JFR['#ĩ¤ѳIl}Yz/8=֦ymzjU)رzRln&cbz׬bh?*֠נ8^ju-1>K#bh}X,GFu ^71"2|pčtEvFH.5br@JFUU+,t+w*:+W(V < nkʭp4ĻБ~r`}ĝ8a6GRÒCBk6HXŭʹ !h&6r,|a7z.yBcȊ1G4$%˗'r7V7)k/]{/ .i2h{QU o uL;N*5 |9(6 m6W2!UCuA w;t T:Qd BJs\t_(Rl4ӿ~&`D3VtSюX,bcN\ HaNlY8311 mъ)p,&q &Mh8  qXԡcp$8c4C0#0b(Cq7p qaD ?~}[5PP @926JD{{'zhXhz ~O?{|o .|/vb>gc|{xm.lǛxc^ëx/%<óxxOI<#xA>stream H\j >wٜ%PrNReby6l*s)do݀@q;@ڂ.]bqi"w8=8YWȁf8}ކ3aK txg^삠+v!a{Bhk 5YliFe̓T?}YV-ަxBm̒N(}H)&,#o0 endstream endobj 86 0 obj <>stream H|yTWu4TuCkԨèC $Q蘸CEE%&2bTD 7TpAq#; jLL1=c&wνz_ջ@\ p /^( ֯26kz~{u|uK؅wMh:QӬt6q?(/QPLmsѻvoӫw>}%` TL:wڭ[=zzw swC 2t{0r>f?} 'M25,DL>#jftLlܬsKtą>|I_sIү-_2m5k׭߰1c-[}ά]ݗCBn#G /*>q3gK|ʋ._zzU5jn޼u|wlFj0_C%ƫa@HR4![]գŞ8qLL׈eMP{F;wgKI#DiX*ʥZ,=IvlMr/<@(B9I O `4 = c S )F[=^Fdbfa 7F WO*ݕJ$+)r%MYd+JRVʕJrl 1 6"LM1ݓzxr)qlm نϚmz`O'qY* B*,R8nZxvSopqJ\+VO&T-WgS$K#SdHnKKO2dN[/7S8t9b# c 9p-ÌӚ)ob|M2-85HS4)zs8ԋS֏S 6Ni|L]ۓw} 8g:[]-]FW4V7^(x~<&Լnkmcmmu.VUceV*XUV~8_ϰ D p%\\5Q*T0f&nQXhD YlAEc#a1>G1/_—x8IT$DHi mmhiH evA;)ȅv9^K(:H(0|:Jt J*TDt\ɍNR &wjCh-y):M^Ԏ R*s5yS{A>u :Oԑ|ɏUxp$@Ft.J:P )d*At%ԉ:Sbl%Kcjl[6,mb@m>elɲX6v=l/r`!av峣cXu;ΊX1;NvfgYV95;V*Ev]fWUv]gUZݨnR"*Qբ(2Q#jVNta5emh檮+}ku稀Hu$ c!@ދرqlL/6]^\1LI2c;Ƙ"BhB&ʝ7k~: 9UΫbuAT]Re겺ruM]W7MuKUiu*YE=tn&:NT7ӉQ͆K"%.|r9_s8jS#HO8p,7܄8)7DNdNTN`>`w{_<}/8 Cp(8G(cp,8_nY܂[r+|o-܆*\kp-7&܌[p+nyw\w 2aUZw*u׺gݷZ#zleZzje0]A@$(Ѐ@`[-B`"  VV64F@CBX}+bIZ[m j ɐ2 vܞ<m;\_C 53 o0ނ"X K[X ;'O/xSxY,sX/` ^RexU,kxo-Xw 9x|k1,ғ>!#(-ȆXOd%AAHMLl$&2Nr)DM? I/Gz^Y^UZX!6@l 6 `;쀝fCGnM }wWn^> mMI2&ŤB7mbX$ebX%ֈ|Q r#8*/oKdV`:qBX+⺨ .܃B5<峲#|k Sw9P OBK"2Kv]dW-|#seO'rHƈ9A(%|]9r/r\.r\+ r,"Sr<$?E"dɟ Bgd,e,7e'eWBi(_E⦊Uq*A5UTJV*]e,Rej:NrT@CTTjjFjxA5'G؂}85QMRS4>;,ȉwT'pl]؅]nNs9ÜQ8g3əLwfJBePE*t/ T3Fmȸ7f70G3|k7?z3,ogoΟOg\-_W_9a~1'ͯ9mΘМ3E)6LhJ%Sf.+)7usÛ7*.X%EԺDvllmMmخپaGQf22ra:(X|5{:8~λ]$QK,!"HTRL)6JJ)#%veZ5cԄA-Y,e汖yjZ|33{jZit4uYY:,1Ku,3u}CbVd5`X߁eѦФQS7b|*`X&e#ޫ0U{Gȍjzn]q"11#PPcy&-Qd)m\`v=FbNϸSޞwuܱ۾-moؚ }g}ܴٵϬY_nEmM4Ami ՚UVgO;2Fn #X:JdXiCs)M״FLtSw{HK>闢dL;_P_>=<HȊʼ=祳pW\Q6*֮tfQ(=鮢IѕHJ5j $ҹi54xmoSF*/>U*aT8":8«vϻTT6Y7-sȹ!º'$N9J^wD0y煺>,[3z" D3Ϲ2!4sG}r;ţijn?Wts-g9}M%mX_nLUgZg#@C(đXS'f:wB ?׀9jRY/|WDL +B/.ʜp"jW*T7sDRxȱG.R ( 9_,4B4e"#*3˒{q*yVcfVسks]xg|tD˖k;8UYy֤egR42N &puSO"Qt"b=ݭO?JOirz2zYzu^ :86ydh5?@y@Ә)Eؙ \{ R6Jb*ŏ-2Rd+-Io;Vx2\jjo,"c[ECOv.ꕤ+TRƥ3.>MafR_Qqatҙ c-0S>2g^ٚk2L&h@inQoD- j%4/Z/>/jՁl|VKA_bWE}^T֎Bc]A9ve&*¬[܅.nU..ۚמFʚh2P!sV[?Ys_ߡ?>i=&IGс,j*CO:5!OJആRv''QYd S]=񄬃-|T$īS +UK_|oi?wЛD?z\W{@&L r`CǤ[4'h+`ॻ+.]֒iD_$ڹU2o_O^NU (-1-WG-xvo.mkg*sHc/™+/j9qˑԛe.q&8 C",cŶ a|9>7 ǐFaK,y6|*wcѨ<B U[xu")s3e7v3'aoVZ] ]KmoyeD;=lC8,5u" 0‘X`EUKEO8:ګPC0y+NyȤ~/AqBFWYl]4V~mljUo[yߋ ғZ=8¶CBEi,#%󪽆BF 5Eá3%1[h]2u/=^cpB!ސ!H=CO{"D?ϼVUԊen|q3o>||8Fa5g ~J9,5\ Yh30x9y4od?н ew_n`h.9`iγ-|`?z" 05}`_9F:=s^m}fXāM|>؁ ܧ9^suMȿӿqp)w4w.>X$q) Q б@P:x)8MAs4t~4Ot=%uBv&|F_S 9i `|{]bR' w\G؏\ wpt2oڹ'ن+QOF˨ZΡge@Giz` t&& r s5I (6A!VDHb##|cc56Q EMA ZQajکhũ` -:6p9/Kgk^+6ivCd6>CϴϬ }7KmtMYdy5Z[}Jm&bkߵ?sMu1ge`}ۊX iYfUU/jkV'Dȓ2:|-#]t5SHOgVw⎔1X8c_qT.QW)my^+lAm":Ǵ9盶x8nG5" =^ 1%8Y>lOFLOA05**Uؖ\_˔^\B)6y| /򶻌n R~9,[Fb{9{^wgI6#{Ц>;QZlr6?^u.y ~2Ϙ΋g߸]{Dt~4Fj8sN3vq}ȸ?}0]~ilr"`#x+ttdK'ʣxYƳ66VZz[Q{'Zyׄ>>E)1]?fN] Լ9]5-zc;^l(*deȩU:]LUj*}~* N8Hoƭ:(.tn-H&Il:zkcՅO-6`M@nDث*|hmN\lbW0o+&@kAy$@ڳO1Dm+ZOf\2Q`'{>aa~~[/:@ Zu˥;*=,rF`sn7W~_⌗١ߚC2L<m~~&ϻ92Ǽ+ϛm#T{ t?AQЫLTGK~o-Wpyę>x_KN5&NwN^ VA.QSGQ$"lj%_ 6fG GwE:4 5a]97¹p%=|G*b/Cv;F П GCt>L6o!ΘFt 9L^||'b3"8NMWhe~cfXɏyzi֯<5ؚ8"M  19ÃĞ(o ؘT|@!׽M= O{(|4iQlc/y9(ĜN\SdgO3ێ|^WJ"YlWnu@v:xv.qt?n{Q=3Xw!w=-'jHw[FGd80"̡?C9*XNRzYh7bP j?xbbs,8Nsv!jsn>!:q_.WU k}CsMup0+O{˴shXʹ;,ޥV!po.7,5eC ,56X,10#}*|d\s/~ zfYqr6JM`vtSDZ*bDGEt":aD0ԉl":@E%1f77lfF9_~mi_=<8W#r|1,/?kGBc15ʧA|۹.eu/mW A(wi~ `Zmؓqp:ٱm;mY+9_=v<3}b7F{'o46v{p%K5]to>aKw䐿qzXbL11n&K֛xΗtȓRAcxp4h 7 `;8Pf%&t[.WkUsxKrF\x1E_N0m%E0#NY7W]fJÙrnpT&wp_A8,S"{&tR͜}3;Z~$(5))gE~z dwT͟3{DOݓ(5Vɪ3#DɈ̘EFE7ʸIFQURXbhDA}|ڟcUv welG4AĘ\]訌&cd3f 3WRw=)*]hTEv,5PːR)R}EF|Q"8 wY5k]'P^>g:_huw]}-rJN5zj6ϾaЌNdO;'yF}@\K( 5PZgֽZ/ftu/c9KklFwqfzNt6zxM+elkDe"EpbuozJp+M oO)6" +gOQwx]"q+"Ѷ@09vLOi{db=5ĆLsgxi-UcnHERoNWpj{/Ϡ~Wr9OIS7+ٿGφ趶r_H=^NVh[=Wh%=1Jzy{ /=o+y{ }}c-ly~ _(1^vzmwgveFN?Cd(\c#qR {RWOܛ/j՘jrZTiě-69+}ƠTA4yXn>ŔrOŷ,x6ژ Fƫo~: a,l3&7qB׻? 3Hԟ^rڲ5nIlеiumz֯5*Ns.9-.'d]"g{}At<͓fXZ4>I vѵ .!Vi1yZ]V@ޝb !S'ӥ_rK"dw#ZLt~kv,hzgSKٟWi!; x"GNy܇~)nkMp+"jzW(ߘE 0A\,1W&8|75A5B&<)oDKHzC#Z/XַSjrsW|.dv $Y7^ϗ +e*a C}}gm%o]v_S{kdm|?Ǝ\gߡl.D+9 ̓<(!w*5-ڌ3t#ƇP9A|z ##l:?9):1§ )|efft.sѹMt޳1}K:d`tMZ==_[>0{^'7 *=suiæYCMy9*W}BB#4?Zc-I4 L :e6/ɺj; tjTA R#?X)aU'8(jN[kmsmXM;ǻsx=;txmΡhYo95>n> D ]uu39~g^#ccM#/5vĒqF*F!=:m Y`&_7IN])XJr<>O`EEv>>Yf{(O{l_eA ?2M/^+.F"^KK`be`*0yV┽`mT?X/'Fcgz0k!kLŽp]:ud6uML33d׷ٗK O>d!ݑ{X@e8Gy˘⧩K;@% "#A@>tT hXJߧ> s4ÉU6{*g=Kn~qfdMq߇jj8})gUyڨg(>'!cS%?@. y4{t{SҞfVdq+ 6Pʑ99m3fO7n1] [f>h ?XF\6։O1^A?oc{;)Rw6J^M"i^JM mu@kh!#^Z{[{OU'=0fȻd|O/ ԋ8uT(D ^o"\M|97|\i5ȥ < 9MŶ9 =_\E ޹3|k%߇Mo,q|;ms?6A?B%@"a_6ZhWT~ ) O0/ m /V|f"7gt {2NjXus#KsJ|K 0K?x އf}&=; sZ`mZ[ѕxi;vvJ<4|g^}xzR|E6M-)<;oI/P( BP( BP( BP( BP( BP( BP( BP( BP(3\D>B 4yM3ȘdAD<~5@)+uPr2܏9Fڗ]}rZ,~.&tGwS0]C}]@owt4H&UPS$ Iꡘ8t>([bIux?I Y -^߀lzPkz,#7O#v7옰 ,>ҏ922V2Rr >X~}m)m@cL̉!(xZTrpOsLى:35e/xR;lǻqYӍVr&c īE)߷d 't@ΈmMY@ _l ^?ObA*,-S3J'; {13hVW-D=1˼;Ed0)5fs30_gJͼz-n7ŬH v'p#7XO1|YY¢j :z_P팘݁LL;ѸYl 6Qtj&qў\[fw$`$cI[u,j+`SfJOP`8Q/Q%)x,>3._FNI_I5TF疌s/ګ66 ^v̝p6fLNzlw *!H RaTGD["(?(Qz/r6ܦԦT"_N͏!?JRwywH6FzD?)ܗ.= !}Ɂ:e8Yi!\1N<޹[xYyd4Wd`ZlVY«zE9.{ >2Dl20\xʬ&EQZy(FY*d و^I0 _D(p>Kit_؄7J*>^q[XF8'7=^pG\[(\d?K/HR%eqK ڍĜ#Ta uZVaK$L8˰OK+e`P8?blQ9l0׀%q~ I `X}{OI+`C]\ֻAvMvCܖ:46Wp$QfwoŊ2pf6M6)mn#X~MyRj#{8^4aC#1.Ut  TvE7ev5<ac"߲_K~)7엒G M7Iy:!pGR{WR lsa@ 〟ͱ6)F#dA%P?%/:-c'.1x0,OP8vROE3v2vr{W/S{ڧ};&5jGmQ{nTz6 ~Ejv;uʬ}bRJuc Vh+|+9k@E,6O:*7lOgqɇ7hḥ l0 \ 6za4pFVxYL :^xc8pV%ʸFQDYD"ز jCO}Q/IMgbfWyܽ5fyj6bVR-DSo&{ ptu|m/U>?"G;ߊUDe ѥtZ__3H\t)ASZ/FQ/仍A8hUDSGwx-߈!ۉd("o-O>,Cֺ@>x4 x%XՐB}PUUկTueh&%+!AI?Ą_b*û%r{4\=Hrt{beZky N8Grig+*sORzþ_d _:w gk 9n}H՚w{s!'nyՖtIHRs~GOg4%V"tg \:[aܒ:Oi#t=]C.!u55RB7Ylf&ۥ/vRSlԿY耦Cj"6Y-4Nh$QMJCD>$%{JUɹ;s'h~qYSiӤh,;ˎ#γ'59]>stream H\j >wٜ%PrNReby6l*s)do݀@q;@ڂ.]bqi"w8=8YWȁf8}ކ3aK txg^삠+v!a{Bhk 5YliFe̓T?}YV-ަxBm̒N(}H)&,#o0 endstream endobj 88 0 obj <>/Filter/FlateDecode/Height 236/Length 3066/Name/X/Subtype/Image/Type/XObject/Width 500>>stream HYrHC}Kk#& %KP2mK$I$I$I$I$I=CA#-qճEYµ󷕿q--\;G%NƵ7q\;#aGƵviҶ?NI 8 ¯qx#}1b6LiC8s%Yd!yٜ#ƙkXh]6/5,bS`WMH:mh֮kjp%l*=Ӵ]nķyL2eb]/g:4)4qv1k8nZ^q X+}8L*a#pZc|'ֆb:.NhZ"}Hiq50E9-Vz l rVz߁+lOy+@#(8d=ƶ5Դ+GP$ضf{j$RLTaN탔!1%r.cq+HJ2dRbgV-c uL#P k8yݷ(fziE2UM[qۑD90ӣ+r9TjbM&ʁPM"`^rl2Qt lѬXZrXTdfĪ5عL!7k$fh3@ 0Z#h$6>Dȧo͍%kDo"Dkȧo͍%f/bDȧ:5e"0Q 4 Ykv,,jj U-vXMM3h?ܐ&gPnZfaM/Cȝf&M/C1Saa96b Wf|G,0Qf|G+k1hN{mw^t׵P5ץη^u|͖M͌c%#z>x3120>r]<  `ޮq1jc\oOqVVy ½[oSz>84vљcfޮNuO1@"+-jPуz>K1-fObKPO ǵޮäz>sӵ"7 {o6#hٞ3,ಎCt)Yǡv}Ib ȬP>32qhq]ɰ8lq]Rk `q P>xN<Yǡv}F;J$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I#x>WHRCs0]ޗChGolih$Ol?MS( q=thjwq9Tο_vw]?Χ񊟽fvw~U7 adU$ Ex1L#g޹Q]☹#N}<oo'd}h<@Vqvwߗά<عX9C' e27:ft}v&K"=GDd#^(.쀍釸aXGt`_ɤ0>_]r wU hw7}0)Lbxd;s~\4cCKIpx2±0mS\4$49$|  o-Q%]v|k7,zv¥"( l ڹ9HSo,Pio0.a2{V)V7=_gv#HoXM\?>vW~OQG'p2, ų3s bcgae#8<_F;bMpx~vH؇޹_$sPsff: 磗'7; FtH쐬 n>tȼW$lșC!1S $5;`~XSCŠL0m{zsfV;ώu '^0$6 ێqй 2cz^+utBr\ Nſ\ND;v? ښA^6sDd!;g!l8㍼iǹs83PBx7q>stream Hb!d kU/$vKvݥ*^H$I$I$I$I$Iױn_-#nۿΗ/KIyݟ.#2G۽/eޙ?(]b5xfpt3ñ29~$~>Pozi{I<M~|ͼ\?e \oY% T[|EGw&"%+a!^᯲'4fbMD~z14[P<ܹ^O1:VDoբ0fqr2Fe矏lԧ ֳX0`s]FN+[(VdAik9T|՞Rs5f&Ef*SHV&1Lf> m7rmbMڦo3O4h&4W2vvQ8WL[iSm!M#kTC-RI8áq?zmbU2Gn)R 60 f %TZ_.`Oc/ѶxI,/bשZР~dG"%酔NE:խTO_~CP::*5;1JZIU `Gv݀!x΢K،0|+m^8X[:sKhegW߿cBID0Og}ɼ.O++hל~߷lo>󀞌Q8UL27eJ%hל};Z߽M3,I5 횓؃p_72r1so  ٝD%9x-2m/tqb e>zToϵݞ9#W̻hg\ȫ{BWΌKD43zXo8kȜELjgF4"9;r.>2rkhc1Q|EXFs鎏~LjH,D46LcLVnmLjH\QheUgL+-otq4={k*qG{/Ee^*cc6Zhcfk.mOXk1r[Emt"~s_Bk]=F]p+V8/7FI2_wj-D41p;[ͭCLjLnZha;̍~Uh]=Fmt+F^h źZhᭈ~d~W} E͜WQuh V5+hiz> b{%-NVm`ūZal[m2*^T[܁2syZO5jpCyZB"7O) ~ڂ|0-tf^:Қ5HMm2yFfej*d撴mZ*UabeCܤ`!hF*MךU,8` -ۡF2pYM ЂsF ֚K|C0ʄP%m,\Bc5Lhuqk͢T&\C0ʄP',XA3Lhikb.\C0Dv[kUI QSwVZk.5N|pZi娵f5ӶIuPnk ,yw~ޖ,{h`Wԝx]40U o<2U1 ,ksDMIZŠ=p lk@y4pU oY V1;qGwsTN%N$I$I$I$I$I$I$I$I$I$I$I$I$I$I$I$Id_ZWw-́Tj'V4ߗ/mfe2rQ5$#h3f~7Ć 2/J_λr=cf̛+#-f荂 ̢0б5+Vg>>joBV'1QTtw9y3)B9wU6ǯ__ncn\ܠ'WQ_ۜ $ 5՝n P\I1 V)FXhb]mnŰs=j a2 wBRAD,3ޯqKzEQ0)!!*E5 |=Mi/ 0++ (UTjϸ6ڪaiE'a17yVṾ{:fNETjo?PbtS$HZ2T1jjR)љS⡨$XDeDWcEL"բ2/+ pImf^hU/ZmQC.I*eڜۛRTnDP&]&Η˿Ur!]X](I?vj{l-YF'>6o/05 8=QskU^VXaP"(W'<<1Cơ=s!&N,"AV ܓ>stream h޴[O0Y!عWB KEeAS\a;D@|'l Zc͵@ϵU2KMzljz)W{( \^*\Hł#X*g(%/S|*GՈ~ɡS%BQgnC]p>8 NaX1%bLppL`SsOX`T xL·Ul*mۯuI^lD9H>/kRwT1[lt bҗ2M%IᒈV|!pu2r{?T:I_Zm{Xs%\ Bk6UVU*+tp7!F[/߷;}KKO-q'hӒn.g%/̉>6E81 SU=Teo&o3MNp,t81PJmgGe\6(&Q:ڷygx>kY^lpD\CoSi0r> endstream endobj 91 0 obj <>stream x `Ž}d˲wYV,q'1& rI[m-)G (2Zh ^4@RwF |󝙝͎Vٝ4K"*hiyt-#*{R$k>ba|c7'; W3o"Ҿ(\g̷PjzV.tq%Qt"׍V{7}a3TΏ(t,DVgT*D=!מ??"Ɇdgkڤ~xO7NF]Ir%dr߂󓧜{@I@7;/#D'fm{+'J;p_Dm8u9gU\H'?4mrbYqkw}xIppݩ }@m~fwZHN߸)ߠgX? /u'I>'^kџ+ۏwf,7?V_7|m'@^πo7|<'d?*9Vn)+!U)&u_5/NFd1h%vjR{PsTJ"xg0G&JeLGh:-t&_3Onk; 8G9?V>C0w}Y}ӷ l?uE& ut5#}5}f ktR)Õd>B;vaw)c@} y %t_ n qr [P/|+/8ڍOXmdl!?t\C]@ ͵{]EN] h(uI]@ @ @ A :54_w @. dk?4W{-Ү9Kix[h.ڋ nF߭N?=AuOѵ] Gu QLys,.uvc,?Kce=?zôF2K*z];ѹz^lb]4+J#|Z- U%2Sfrk1ǧ7#тsMyf 7@ uFGz" J:ueivlʦM .Ս(GB'j%mn BZ}OW;Uֳz>8O&[Ju XTGe]@ 0OSMMԩT3&"F ",jVS,RՌR>LkQrY@GdH' -PeaLwD&P YRoP٠v"'9.nrA='#/O>h!SoRB\(o RZBR B*T Fj CEe4 0ʠQ)rhש^*P%uT jSRAit&4MmFh ̈́B_mfh;@@_ SS/<:B(]@Ѕ\Qgj-.Џq=BeMKˡ/ XEZIGA{h1\WQ7K+s58ꁮUqq=z}:wc'qе\'鿠''n_$~BOuSJ롧щ铩m~NAJ6Mt Lgѩгst @ϥOCz> mL=KM ^Hgt6":9:y_KKt!t6CE+^I^E_HbVz5/ѥ e~G@+zz]*i+kt5\okoҵЛ:s os+N_~{7}t; z'}zMз;&oiCor=:L;;{O}tt7 >@;{( }??{?As1J~BBJASG>F߇>N{{A'CPKW\qoaSSo?#ӣ?cGO  g sKпp+&3= ;=zB_A_CA?B_/CWhOSzuz/zoK&7[w<O(E/@EO>>>ާy2_}˼O>%ާ}>ާ}>ާ}>ާ}>ާ(I|>OOGx>ާ?E>>}GOL9_}O>uާ.)ק?#tѧ>=.fIejd߷f`4FLbh6~wEo ZI4bzsn¿5#7Df-8R>8_Lŗ*@um FGSFͨ5dlГVٸIg(ZlD4A8c QrY@?&678 @ah0M،jr27cs3#fd-w@ Ժڋg1Cqdt|nFkKs3AAX|~dts3G[>EL囀h6idL]le T^k4X9P>19 E|l&pŚvD]@ 0 C?:z7d2fɌ6h? & ?2Xh217#|)JOth:m{2OX,fբ%f!9S *Ig267"#wPs3l):]݂# ܴrW#Q*@us3 SulS.lEXgҚi37[?ۄdi gv莒Tln&=7;67c[ۅcZժ%ن YѹޓXBZ3&߭|&17#<i1EpHN5U Sj/f wCAzmNgPͰqh6l-& }AT~:bnF 0оN{[fnfL͠q>|n&j7 G8bn&/Hi@ YZW{17s``#s:@)`܌lXt 3&L~-ƞ' *r;LOX84>n۬V́2XV+Lu.;V#b/c!tW;|n&j7ɯ{. L6~A"{c@ YZs3 &6bM2* Fwzf%^MVݦ'i[٬.e~-ƞ' *un)JO l_62ʹ|p:<.^F;RWil"DŽcFH '`*0oz:"8Hº|WA ,]CX[ 6r&wa#`w`:1rpa'.;m1EI>=z .o ^.pݙR.l& ȱ :r2uq><9j7,#0Wjq!w@ Ȃ38h<R`xqit]2N尻1rٽ.ÍQNdi5Ks:9Tfsl)i'z=nH^w!{ 28n7q b.仕Ifn&"Zɯ% LmIk Ab:  x㩐Rmt;b2. =NbD&.;7c]8-1LUx!L\زS& R}>[P3WXPwtnfxb"wN.wnB6t)wn,YXQa7-g$Z5*@O+pHs3 v7vI2*[}E4 d5=?NpͰ']f17#|"Kd6[ҿ`KH{94bP/)6Q_).)*A(\T)ffB~`G[Kwxrέ_\0M,DY*@_+pHs3 Not(3 NJaZ{=~ =A16tس~s:9T%֣}ӓ(lIpʿrhl` Tj@4 K`0S? 'b?'[?{#ɓ.pn炩~]-8t|WA ,#x~aЏ-b P(u$;L[f-  }b+|jq0X0ON[GI *5kdsl qÆA)֮WB,S F2,JR)% p9E@N.wisOrQ np,D_&U !E<氡 ]ҡ̸J M9ͭ[`FpIi@) eœn㌑rس~s:9T~]9,[cPʡeee!%Zf2,ԲPm()%`s)0W* J\TT4d,Oκk Zq @ dt,!k|blPe'C+A8J T;)r5 !DKJ&{~š?LSYTJz-p;p*FBh,-Se eL)!lP"VRY:n(&cyrG 8LWìS]@ Fa_)QJ KKӡhtN[+ PCjH 9)Mc?N( Je!t0)ƞ' *twzLqhlX, Wǜ ψUGER06O8 SgcS՜+Bus=L&+ܲк)U ]CX#(P: >UTaWX%. J#.*+ejiYfڤe~R}&UN[b4't^RUyCcG84꺺:U5V7UOʔ櫨̌r!tW|$yr}`LW|WA ,Lw)]lD%etZעE:ۏ^E+y4b:)[ جIw+D3׏7˓>f'O9)8g$u?w@ |W2AnlBUͭ,`⍋ ^LQ%6mNKcxy-s9yJA]8-1La _A !_#^G*BNFTCj:Υmt . )}\5H-Qkճ"RĞ4h,:h))"AXlbg֦;l#_ۈk3 Qc$IVǃ+µ7fzHytzEjjf74Μ:-S -^cD˺Xs̪>5~A溓{+&M{wLO|٭-M3gTWU*G#ei!U)-  >or:6l2:,i+OM%EY<܏KصyjϦ7g9OtXNSm*+&V5.EjE> PjWjBӧv%ao>i1w;כhق?!Ay G%B0 }g^ mQwVbI'UZׅM1\8g ߍpwg˃]',:8xسwիQlȂ88KW8tބbRe[b{>&Ly [LЊsC@ +5B.u7J-Y@+*EMtON#K!;Vb4VEMzxML7b~Z:#'%L}V'tgX|/==5bANƚGÉD,ƚ)8gVW5, 8Ux8}ԍsۿ?bo8Hbt\\Xʞ1,ehʘy_-n&cӵ5}@tҕˏU2vi{b汴L(앋LH*y*嚱,kMh#F.!QuAٷ(͡  ^bV{,SDk{O2-;8h~Ot@ ª3P9?PtJ|4}ӹgrd)tiXӻsDVb4zES1/Q6w]p9*68w 0|w]=6_߼[ASvHvϯ~_;Ic:PPt`V '#ZEӣB;i,&ߜ\[Q@g6}.'J2{-C&+;-ܪXVn3]ptMp)8v3I7NaAIWɡѐүrssÐSp_n8QNBWj}iz?Kz'oA"[pmP X-C+I۝kL8 F^/Fa/>{Oב3>po"\ً#E}Tb̤=}3cxŝr!m(z'!ﲤ[|lڌ\~ql;k毤gda{2{pZQ|/$ p]r|H;Y.!/r)-PyPs| +nZsl=&yRUx:T\Otp/DBĻ6wj *5ˑr9р|6m a֬I]釸VJìS. IЏaix~cc/Va6P"8p;"1>S/B{McE5!i7k{PΪHwWRϼ;u*;@;mLq܇4ҭҦd0Kj^Em$-ݜlblMV]Vik)WǷuQ&uᔮBrϯD*]6%:kbKm<!:R_⡹Ŵ NB]"\&J=΄;,`1n1X b[ ,`>Xq>X}܂շ}ܢݰE7E7,a-a nnEqXĹEqXaqXauE,E,`Q:nQ:Xq *,TXB *PaBNX8aᄅ[8aᄅNnϙpb#,F`1-F`1ގd/Ld/7 0 d/Ldoo'CBBpvlvlp=y lH"H",",b,b,qmm-{&x[#]5Z+mTpBzГ,gh;ϧqGy<:=UW峔aWNpk)|_ {2E…Tvn1KiF&vtݗNF^2zaCQvW.޹J*"rےJ#O$5KFS:lcH2Ӟ+*d[T*U&,w  BKdG '%HQkTͫc< ۥjE?:xdX*nVvW;dagO0ʍ(KGAQ6bIsn{JYeDWV(`RYfդ՚^i=J7 \WI* #ü sUZRsܦ P}U80k4 k\%VqyنaPb(0?Ҿ<*knV4ݝ&iHB"lF!,n @`GQf Kmgppu(WDF}>ߕ{==ۭF]&eʲ,L&2.=w ݢ+%X *RU=Wvތ[TG۱ ٜ[]UڡcURXU4nr[ d%$Kִ$oZMv`}cjk3WY6W2weumUuM`mk1HkZ*؆W#v^cc5ͪnnf;tCnP @F~9uSm(엣~ ~;W>5Fw+w䘽a\{h$2sP ]0u@!lNZs.%sQsP;Bw~p[o}8[7׺tJ8cqSVN֦hCehexG7~qhkkv7Tf/Zuq_V+|!|!| œk q5;d4vXTp}FvGuAVdնZC[mpG}GvȷxP$oyA3:]`-❪ZKWF'p7؇Ϩ?kp\_455ESlBUU%SWB[6JͶ2= c@˧W1*d]i[$Sm`/82g>mY<VX!]@fh+:;Uξp&{M5--}[JEhݳC+Y9sk@艹As~`_/2vNϨs^H}N M%a ϟM|(OB4-(&]8cW`у>y8Oȋb?FJn;J Ϳ.<:4 3C'_w^|_r<_Fg,Ecu}IHF5؃nBzNwvntW!(=Ga27'g@~CbB9=^bDt+Z~6\=E::Lx f&;| ]xpT8+yИK\GM̚"1?z&-d"됅*~&M>| Y~10t?:#KKHT 38s?YL#V[6$ҁ^F7.tq OL%t}a;Gs&a/L|'^H+dv?;BeKIw]%gPڅCߣ3Xtn]k,2"k!~ ew &8xxx/7`{k}“ 0?_oWJdYdY$OGȣ0!A>&"?Pf>E[i;=L`a&$HXR rq8K<)'-O@thʀE?@G w \ Ux4 >܌OKXBM,#! r|@nK4FQtL5̥2t=D$yY/l ni5SxO8/3BqUL8i< g|<|+GE7[!هV9TV|*r@[:3$ꬕ]Q ~ - uAzg[;$kB^C.RN& Gxzw=/APyi°GS(@T\4lnOh-H/ ɯQF7yqWz6߯Kl::QC0f?ϓɾaeh+tt%hq@~w׃`KAǡIh*Ʌ;џ?>'(Gc5?zxK>Tԉ>AyaKxUxW^DhVa7WG,lt0@@gY>N\^EG1^X0lS7m2v>/Xļa`:/I>`*G4MqxH`*ZI54gg{vDe瘠>Ƙ@2^h0n*JcQq pS֊fR4$|6gDgJ6-gw0H$6DTiH`E (sӇ|1Ly|v|tUv~Egę d\|vtY'=G;`$l)YHS;@I@j rr0!byGu+`5دZڱyȘƜ+}֝:h**Gk/bh?@Kؚ+8΢;hIݪǛfጅhi,y UX1e䰦*U]J!sQNֶY7 ܫN%2-NWY?ٍi$N\\ptv=k|*y{1L y- F\~,P"|o}2̊a[{(8 LBZu8CJ Iwp`}u6$j?ogLYc듷pJ%I(ݗKridl!["k\ ~Lv OZ95&?~IL$Nh+-:[VnЪ;_=osC5N8%M> s?P[-*^zl#v ":m/ },s>2HEQ04 7M*n$Y=4+<7su|9S|( ݾ=}?a2'd͙<40  Ƚ}ԓ& 27en .Ԃ`A9";=$l&O:0L.O:W4d-ircQ 8'^G^7=43`0X10nrPO &;w:8 ;f۵2&keYejwnQ2$# hZ5QF eLv 87agdt@递xN4K_DJ"%f=|jښqҏ?:{ƙ+=X0=OvTLwe|竗nn2.,tH/nN?N| l [{hSq<yID!iHȦY֭cmX {14ٛ9C )f9jX=%աBBK::7yzȟA)a@],+/mc77\aMrS}.-_T+Hb3f5Ͼf@UhQ#oXxiG3;͚ywq:cU5S,8ym+xeq'`.ȆYö2Ƭ[Ynef46W pމrB<ȬG{p\n_`hOJ_;G؉Vr{8 } ?^ +6]d{Z_o}cr"Ψk NZtm.=8l/DW $KTDu"vv:CZF mF5Us9vXbo doe_9Yvn{ه17i-!vukZ|&V441g7f›[CN$sÔ1s\9g?ƩvE/A3-MrοE"?gߖϾǹ?y(͖. pVj<ߴnetΰsia0ZEP0B"a ֕JRJ;۶c̙b ݔI<ѱVl d/vb:``wNHԣ5,䘪 \q*[&2qJvX]ڌ 猳i|ILuY׵Zwq U<_zl_Qu<.3@,l98,A]~y3z!oT]ѝ`/~jS3d0CR򨮔<($`%$.PQ}\$Aq)橅ցTD3IE.OSORU"!UI KrC'*-`\&D0^o|M%@u֕ Q:HoĠHo JK6v7ȯfþ7 |7Lٖ]J\QVKuUkҤSfjGN!2?IbʫF"ITxxuibBm26m C‰.ӬOΧA|+_3)tEBcIQtfe;#;K\**/w;%A q )h)EF"p䁶/T *R̚i23HO.,KaEWKwH:]Њr-i5 |.R܋耻5ZE!Jq 9QHuznrkU/=<W{jUqÆ^1UWyovĆV :ׯq WLh {xQP&^Yy"$ kݘ } e{g#z\>}U@VdtEG.?]+j%>'P+jEHf&9c$]0/t5^h_/4[E![ EkdV(,B V  -Eb%_J.Nѷv' MgsN 7b`^yǡ痾~+u/#?&':98;s;qnT}Egl *%\)d)a<򀞥mtmp@lĒv'GM6Rg;3]&\&^WrxZG*qq4Бx i7 c;M=h+n0fWq$8a%!^%R,'H&#P+BcpaYJu8=󄎟F끷op,bKUJ(g r;ޫ$-I"A A*TzC!EdNFP.4"/滟CΗ2w!8!\y! Y+ߤ,O-S΅0hXs5qN&-V.\'mzW`u(%!ƺZbdR!'OBb`E6Vw [\@6?U۽z5t2~;iw>pI?ɹ46q05nsh"$:/i=MKH@8G2^RgpNoa.s~v XOXhcKu%|PfO?YPϕUT5d2M Q҇Bu|=lSw+'ճQ6o+QzdǕT|ez?yݯ'2HK׳Ea{^)iq9mv;x@Pg}BPs\j3Z\,z؟ N= j4'1 _x۔ucfV|1*r[a Yo/]?|=Ui p[RoQ#DA+Ss *rBB=GջsA9x Q(H&9F9&J3-3۔-QEeQu}}C5鶻nm}JG}vD,PW*++q+Vd_f]mVfuXm^Ov7qQ8 NGov"-b)<+Ѣ(F/s֥=59533KvuddP/6.y<޴- Ѩ3ޣkɝgff_{-}fؑw:ƾsߦ3x W<_Ilcz jUqU/w>>x='>LJҽit_Ahț+.AZ^g.6:zkZdF޴>+k#VWRBq^ @||聬Q֘7迳cjwVh-RlYâ3m хEYlڬnmJ@&fQyjc;;}NFu eh$cT [p=^[p+22a7_}b{ܜ@֪ L o=֨f֚{mc3Pf رT=;v (TP; "CTδ,`Tpwp2[UVh>~^_^n+*> ݬ>oVR[0GI|ɮ$f"F]Áͫ|u|7K/>gr$\0IfBn GB e "౞(뵺@Scwywkuuw(y~=p?&_o~U؃o;^v zE??ͻîڮnkڢtIwj̶A`-KTEVi-'I 刈,'i Fpbld &J_FeJø}9khZb33}*~}ԩbǠUAtV/ZDIt[K,ͱѹɻc A*FD,qK][anI;L"0 c`U@ 2EPuG0$>CqHq,}*{oZ¥U|ܻ{9,WqZO}!s+O 蟀m;-l`#3߈7&~9Qvr,O(Cqa"/̂Q`5az" CԠ.}r*B*M?SJ{ɫn3sc  Ta9Ql"??05\XÔ!@(5)Q1:0@#/ja*"$p#\\QR B*psN(sʞ`-xG4EEpPjx34A('!P$~-QOJ'U - c գ IzV~B}_woRi8-rDB\ÂmV½5'[wpeq>)HFCfA9 zU|wj wFCjQdȒ X$j.C8LUQQsLbG0 IJ#~ed8jZ!: Bl`(Pdr#k%A5h/&1aWCc7`@N~U(ϸ\ߪ R9(8^s_c~jtLWەMx=(n+O9)b)&)Ii7䏎Ϝ҈`KpV#0&@Г7BoUAz}BЗʼr<)^W9H~Yii1JU6{|rvO+q ipUfFtL oE"fWq%d(,F=1gsZS+PVŒ#CijɮlFr,Zi7Ë=} _?_ *b< 9O92e)IZR]@Friu75%c¸F)C!l8fbнw`3=:arsW^v r!Fkstj(>Uwc^GNVp%o|n ~6\O<3'6oxŃ"Iٺ47dx2^heYǎw#[iuKb 'zz7ѐ}}:m7<$Hby|RKXib HX2kx2%mem0TWO9O])ߨTdkoris1u/6[QJjM|~0@InC F9 &٩fYZn @qYVMAa)'Xa1+^1˔x( BVjPAR+XuFGcoX ?2g<`߳2Y3)0+}!_ *,Z@#(?䗶][Wⶮ5ͥ-@ 4.Yv^]q)Iu[QNe6T,k7^)L(By&wob| {d1jhD*:D8//vGԶ;b N/ip_j J=OL "Ҍ~$6a+<rA}ƷhLV/l3 FmWA+%q|FId٨JOwkU~as\o;1w-ӏ>՗_#ɺm؁.3p~g;:"Vǒ _wx.m[d[⢲^uP%M4dV& R$9*iD*6Zz(ΦQVD;U- _ɵɳ1P$zZcm*x=F O|_/kui?ok%ep =~C54"AXgXRj#55qRd[p:EkQiG_PP.1VXx"fDTB87V*r]{5u%DsW~'f/>G8YqҼdqN/sW }޼I<Ķ?VVA2H$[.(r{E<8I,Fn;osPs~=^̌NeTEJIo j.w6yypn}w<<<8R.jfWk8ܞ 4UgReFϨsC+ZR3Elx>'lqaHIS Q=Tşj@Y Dy)|: dbk&pM&֖W*TRdQxZJi& 4'h]ίVյh]˯kՏG0XH>EGi'oѷJ #a<5W|l_Fs! e aByK/d vaHN |;H&L}60ŗ6z1(]lx^I V̛:"|@pcHxz+<40;^i([pI\mVS07jU&iσ%,#Fp+e,"B ζmm<~~#J_9l`H)S5EI5exLq&[5kFe\<OTV_X6b|CmlDK-@ ԣx|P,}{}e<5VQMa5fXËoIw8iH*NF n&-`]YWC܆d+!^gg4#(LV76 /,/+~o^qOѽ6VUb_~ɰZaydu.H-HA`?kDxtGe/;/_=g0A>r3 :2p|Ɓy1u9t.1MG(5h桅h1ZvΘq77.qieؔ YyXce,VKWy@E~t-aD͵W|a6-lNAh W͙s \Gl+><^ԁ:Ԑ7%?1Jg p3q&R5'jj@^cK Weg߼bl/ky.geM8eBmccanY @E@17G3pQ*:QT_zE}[L uEUQ[3ٮ3٩d~Zq:5>cv5U{\\4;x; #|{p犖1Ff,SR_^ cl/ %K$hs/`ܢT'O:F64۹5Hٴ+Fmc'M(&kѲ0pB.-}(xC(zcjI 4K0xs8K=!sf݆q`Zz3]Ek\R?lR…X#ݰy#'Ot8/^0mı [GUe!4ץcZ|zUio*$FjWZHє!gbB*ܯzN`|yh˗LxR܄0I~+k ^:x?L{v[-ؖȶlyǖ=َ$&Ȗ+q,WcB $a)v{)M+2Mi;@ivB,{%!k'9?眻U(J D%J Pe+e4K7^0aж阮~Lg$t?m3d1<]gL^PêIZHd6u%i'n]-̜1K 긪ixCgo b^;z`[#gj?|_lS[kR-=O2Vk0Xsl#㇣_:nVlwoYiKdS~FζfM=׌yX\ޠ*(bȩ2329;̳[,f{ SM <´4amY]&hb#ҲctIϾQ`=se=ƝW)y޽7x"ͥ5zƽwl̏j7X͕~vFFQ 5"ŔѣhEQi*fҼTaUI!hZ.UGϕtF$2js'8揄?8z_]p jvvnk9]R- W( 2v-EF/&%qr;:r "fuU0.R8`\jҢiQ+z|m?N1Püp^NjDVQVBF/,_ZcJָL빏=OO.D>>%p{U)5jZ5ZF Rm H搆hT JR촸`r_qH:`4Q_ (vŀuEB휗^~RY͝^QKY_<f+Mˡf 4],WXe ݙ:kp 3 o蒚Vw`=c'kրlǛ#d<ųɾɜ.}f|-(Զ2SQ};c)\H8+(Ȯ\?znATlց2#CT:n%T6VZz_>/4d(GjE Hm\>#(J E\!~<-4UVmslt:[mG|惇;Ym9_d^;CL[QmΦV qӪ{@9F+"evӊs8Gq3|ϩ:9aV^Fl9@)(H&L̥ %aLgg.\iME*$٥ǏRn>do5ۛGszwk|ͩ6e0 4l-ҥѬc<[Kw{\9Mw:27ஏjH+i%ąg]ebg-\Xl.z\\AQ. \nAnAuTY~Ntfr(5@j28i9 邍}YT(۔7*&%W rQq#[TS;SEȰLIAԳG܏pgU;b ə~A`.&Wfb&~;m[UYUe/a~+Z!}nT4ϐ){LGZJjl|aMiI6;3wӓlo! kjuULwӏ]5`]N粳1%Ao카3\a;pl O"74l||V%,)Il/ǯjLq(K ~ m]T)fm(Y_ t6GqZݥhFעNfoTno שx8޹pHXvh5Vnf hϲ#`Ul5ⴝk~MX.y^r7pG;G[|䙃_\ePߺ]m6[hmH䖓>][z|gw~7 1dz~ϨΝm9n,[MLqp)O6)Jeٝ`p'Q'8׹+OW_@΃!W$Q=?< gޡ[X+4/E3Vvmb2P1ctKmŜX,vťVtNtUDAgg*|lUq$X 6őNnz`B[ZgFkw;RaX3|O޻4HSwzvg(mxd^k&ph8N -"Sd1r\88STb? Ͻs'Rq'n 'D^4fFpwm"׻;*A)fRVA$  G#dRGΨuN< <8Y^菞g QXӧEgVÊYX/Q})FX=+c[tG"@;?~km7wF?+[쟀zp.G"pҮCP1 zX Yi,0,Y:w_zZmW/҆& $+-YiЩlt6*\Z`jOTJmI֦TY4q4AW G4Fy[H x[ pޅ{M|;ܔO!0jSs >SPiѷ%o%!6VU+5eκBc|ͅ!#+tՙU66, h+;p6qTI@}]1R,|Wxj:]c>8Hp*_p+,Vn]Jg j[`1_$`ڠgG!߃+ʧˎq2*9˸u+{\%U1L:(I+Jd*fhkAFٸAk\,T٤cN;v7EUJL qr4cꌩ]2rNGަ¼M7YSl~(꫿9)fؐ_:)pIA" ii6sٜbL3Vj79TVIH1 J^^9MԖ'X:~Xa vV)Gf\lga-oJM\5槝M5k6]g˛_#ڳSwlvJBذ2W]B'˷zGjsUSc^ v:r+leVr'Q-jAN'ֺV:& + yk-b3Lp. $3LAZHOH<#{7;cbcϨԟo[QgX4oqirWMїL}i^[uw^Pm޴[.ۥϫ\kuT+F\KӦ,%'$Ϳ]0t2MӜ3ܱzbo \o3on0rllh^o]?5b h\1q7i:NRl`*8BcUƦjV$3!:R˞X>I2c뀫Kx 2B;{Ekqôwh0zѩ::հ//“pl$}sT`?G03S"2Ex!\}!tq4~t }2I۩rEDt~rqOU8m!G$ݭDPQMA|j:qo*!D0a@XqW`oce\h!u({ YYN.}q'7*zn'6q-nBe ^&: e%JAR·j>V};8#a}KWn'5V]Kwc~_~A'eHzR]>~Ys5KeړfCow ?5iMCo^oXҾI)c8s4󅬧7g߃Gk>gZNd}^ >dݱ6?XwND G)|vOհU›a5^loY a5հVjX a5焢7EKaJ,%%)*R2R+ ]8LmCgˆF0UpSm_V6TW>X[5\Tz:zOZkm{7ꮯ{~]yo۱nϺ+Ýu_Z a5a/s_N%J삥G n\1ҭS@&!ǸZ!PDQ(-&M@N;o0T Sx*muaM1D߂؄qԯV?F_#þHƬ~uv;1|/Cv+0ގN+ =gpXڊp' g=G_ VKClB87dӉ9KBExm%ӈ\7"Uu#`(lDF^,A!<qy!pin29 # މ;1QVBGׄ}>-M)Ss0OkdX f +H& +~VUǣ&Nm֐ZN mhr)Da_9")<3?'њ_aI2)JFeXE*x$3>֐dNVqi^L[.ad[V@r $22,aULn0r'jO<*ɴ|a 0 K`I,_%K$ /*2f K`I7 ̾l՗0^a䧔^&-dh+Jo,Kb)=\% T?ɰQJ21#=ߕaFcK_a!;8fp0w^thaЩÉp2t*.{eoG1)àSNK|0A aFN:/u_I '%%)OT'o)A2Ip!!2 #HfXJIڏ(S+b,05+Ah9 R`M>Y{d4E&"빸fÊ^7BR5H{(.b402/(km]WmZjEK  A2} bX2L7hIa, 8xw&JXic'Gs@ r);FP#(cG$H\,/Ťh }~7#߁c}A2!`Ԋ`k5tyn"r RʙmҙڌC! Rx?s il4#R29 ☚˞BKchKe8bFۏ[/Awӵ>'//8zSGcޓS|+J!9`fdOĨi3dlTӲfFHPr}cpD-[f SeL+ځ!P; ,)> V}$j*d.]qŨߙL/Z.!ĭyIzYM)yXbV\|&$}KVڍ<-݁=$91ǜ94F8"jSh|o6%qZgCvڗn[LfRi"1W[ˣfy&Ё>LӁ a~K,`[a%ǐ1|bh⽥lZn MŢx8*ϲ>ʝNQj qZþnobDoh,8-'CSYA8C.guUnٹ 7#9q8FLY /p !L8P%W߬8 F"n3&1``Wzp?7qZuOg C9?3bQX^Bu~Jf fܘ;`֣K$i5^驐ϿRz>IT`dNx.206YJ> Wg  Xh.ONf5 ȢvcY547&#t|pop&C,U5wɦ_ Ee14c?kt?fbhS0P+G3ϔ3C$wa`=㓾ndbh 4I|.Af>ЈO)Lø[q@v(?.F$=\8LssƨONRDC/Nk23 NcslβLJ `|6>00]R$Ҁ.A#K {0 O1DEZ#1[c0~^d⾱@¼  eKf'}X`%0fF+ om@_&v ޾]m3iC;8"qsWoClmbWOwWutvv]oL?]0`:Qu 0d=mޖNHz6vuw 8^z~we}m}+mB/m=m+m[!!tz+PEZG]bg_wkdnl<ۤnOWClx:ڰU`b56̂&Wݟ7=.[2X]QځYC"GW{_^h 'm9xݏ%g$t=_A'4 VX' f~EK7+̯?+&2^{B _ɥxޜk&z-W/qTqҢ/楨۽[=nd#QB[ӄnn^׹o"OSϧw p~"x"*Dsm. >*B.E55:)ܨl%T٦~{*ުxr#TFS_97*of?_u?U jW^}STW~M{@/<5W4괺d"u.uS)[[ӝսu!U^#o@?PDIhBwn~#Kz3Hh)9[N ]zW 7!PCJ8Z r ?ï?y} |s/ ^%BDDH1EDDcDDDDDDDHRJiJ)bJC(|)"EDjQ<;]&!!agٙ)+n\~CODǑ3ɏ!#0=1  ?b`AApF_;/z<1~@C$NIIM--1ffv03L3oN7u6sy<#2E2Cf,9^N rNn{QyZ)Vʰ2,k5Z`-Y۬Q :şg {GgH>`"49:ch|$QZ.( ;:t2Bchlwgbgntk[[Goɦ"Bn80(=-T68xlE73E?Ձ4WtrjPp~-Gk9k^kz&Fr;<ȻD%leô|fjBmZqso_VZr績 ]-O:nǩ;S X1Mײ\dZ-OUz2UnZ+8-kcȞ(_2ևΌu!<=)Z#{"1-Բ#pZ`.Xƪk0WʚLi6-%V:DmK(}>ȑn-uǴsAZntzvGu}v*1:-9ZNr'_u*Jw ?Ki*ͤyJZKh wi?tw k}k-=jԇk{`q-~d#'h=eVG>mQ}e~ &r랚x>n'hcro-w:ZnrXS:ZƧE[sYe*R'9K:k#uo<}y˳;h9]%Z(Os47g#IƘӴW)? z}.{iBc-W:rn;19 @>̂a3t̅].-_ڞװH_񢃎Ki\>\QK͜/k{{Y[279MpZr5ۯaGAy-iGǫ'Zjݾ?;ؚZvW92Wߙs5u#ͺ3-8rWCZ6h#o#7oM;b1鈹bKB25Zm_aOzܑ2#G>f@-GmsE̹=FO-5w{ =BS'PtRTm;lϽ5%zފel;)Z+/F.z2Fub1zZ4Fo[mb1zk{c1=+FώGb1}Z>3F/Kb1='F_Wb1}mo7ۢeh}w?,Z#։D׊?tGn?'}t#i$VRkoy6R(UoRK_Q=[PCdccw/~Uwwe:2UK.BC^=IS7TMe۲AK CRXDJ9q :^຺;^""wSrflQӿޏdeghX RU)\6|aˎh{{D }pxLeTt.^p,*ӦT*?8knťPY…k߈=zڅSEIUKܡR W*d+.s*؍ԖmسPew⇂UdT[eUIOEogh+vT`q>7uHWC{lEpnr3tgȹE^܀6}C˹-}*f^`Ŗ6'7zxr:"8}kYuPړ.=g5,27|Bi@+{1uPfmȮjT7 9 7aA(BZm ж UԼ {^M~??<W]?]H?sv>|~i?V5moR)`>A F{ǖc "(S:{~|?WONO*>;vOKԿʫd֧fؠ ]@5wI5ۉ 6]ef(;9U/؏rtT;#ӪJE38]u%) =`.^gj^{bẝ꘨%;9ΖO#KNY]zu~8md*e?-RV3RW-t+v9ѫdPK#Y{܋&í+y )Ujc\]VގsO[N; PFQI? +s*M9U;=jlkS!> "t2nS~%ʶG"pܢhvC]9v/̠T k+p3#ɱ%}O>)+8O3NY]!,]]?gH<'/|l% :`Ia,tF_)>/Q vN*^2_d9J;f/gqʉ:D}ӟnA9?W)>'3*2<Ĩ;wʮ}=_ՌHTF/F(wf^&ʣ?2yKyZXY^W:/wyUP_VϥJ!?"GVjGn,vĖIlITpNVTYyz($3Z;s\ź_xXDܝ#|vD+ȜV{ϷH)<7ۉ=/?=/zaV*"g]+D,ӵVO z$z>aWAkeŇ-jO~f8*gaU[ϟbtMp?h$.z0nv$Kios>XTST["{#)B9}Oꄂ)N)yQϸU(xB~ڄ&WvJ|ZZoE-([-(zhY%S~wHk}}]G?0uɪ {GpxpBpI*,O=7pI*ߗY…3rLK~TixM3ZuTwCCJYU]}uy+dȪwQbgVT;Jy[^ѭ*4=UBGҼt/̻W-r]US(ءt{K~TiV…?B U)#cBѡtY}Fe O 7DW  BC{b[SY9nAKϽ~ZU~/{`_O QzĈKwp(wI0J4XXoEW ^fРWTWt(B{\A["ބe#Tk(Ш濏uWiǚ#⽏3ڮ 3K!/Ϳ [ˢ!|ԏ.9GA_BԘԎkZDtNw@DzVџ+ v0 h`42-FkX`j63__g3$ q"^ "Q),QSDP4ER4Dk^\-E'YDU E!zE/q-n}D?_d;1PL wn1D Ž"Kdb%ŃbxX b!f͟Bs\bdl|f4?4̓)+gڒ[2AJ,kڲ+rX6W+e3\dyl+FvN2]^'2CT7ɞfK*Ⱦ/3py̒ly!GQ9Z>(ȇX'r|h0!lڕ 8X5kj":Q"a7q;;IJK?% a5PWJÙ7`KmX6َObKU ò܈MDlF KkќjZPmX]KkMua}m,]+\^5^EMa^|`|d|ccZ3V_J.75ư`&hGx69`t5e'ЕDj QsXItkR X|]j G` 5!Յ46tґtt-%:g.Jn.t=F _ʠO=|'~u3uo_P|7~v+o'|? ˤ^; HF}6]>9/!t;s(eG{i|5f@v$ `h~ /i|z<~÷'нAYbei|4~?F4,1%% Nx/Ɓ~O^3_CVs`sR& 26b6LeKeFhEMҌ6F¸ʸ 925aFK5}R41fY͙Z0[d3Tkf6J_kE$8!㤈0bE-Q S[u8ˮb.V\&.;ҙךT \\Qvh"\㺊+ࠦ)*&fH+*Z`bqݙndF`F)sY沛zM&ena.\v+sYq ܤX/W?qܤvL;05g_01 eⲻ3- Sa^μv/Z}kkC!_cv8nG##`th4s\SƘI'';OO!~|loXl9/_~e G&0=7[z1sPFq8sn07!GDqmy {> 3Dfq#=5Ń'1>7 fzO2MD2Mb{i澩}O3Mc{Yol)[͐ek[,vxYìɫ՚gEZqLYvFZ1̀e97P Ҋ7eN|9qss8Yy,3l$%qSCg]aurbe[X?(~?_1po`x%0?0_l" >/ta&@-:h:]qLd/`00\c0FCIS9,ˑ r-lv ȽZ?퉅j1s4Β#>TiAkA֏׸ AP1 xPLooooooco^a1Ӿ &^Zf}1̀6Hwnfh1Qc!'̙\s8\^.c5| fw0;8 '3 +@WҷW|j2B,FpBOxO = aEG#0NNPcG'}oyA7 rAFF=T4;3nfs3Cե0<89|Ev.#ac \\*[|+|g^cր~'NbV@<84<<$blM*$#˨ۛTw8W?)ȆImm:0t_$enrzR9/7@Cg!= _K }fMJɉ$4Isa`R2%RT˟˨4i3CK6c'@]! w28ȿ㸞OA%dg˃gBwág1C-BifPGwzO}Cf 0P91Zc\pjhbpvh vf)W(3o9HyPh%ηZnCoC{B_ B{'p>{ByH){ ϓ aLNH+o19~ޟ8 @cr=j0ZV;Ycnn%$d aIH mV 2%` K8>`n<(U(3%KSɓ`Tls3cococye,E nɫk 6Xs=+0g'Ⳟs2jkȯ҆rs>뽂Tykq}w/n?Vqcqc%>L74DbزxΟj~qɜQg̭ݍl{W":{aϿTl{<){PPW太5++5+K3婳QcjqtG-؝wj{9[H.Nt:Պ-DYrgg S#%]l'T y͔%۹Y|C9!r:lu؃881gކW9qWTKgxQqḱ-ĻU=QWicܿP晦|6,9GO8/[?fnwRb?OYl61:ׄ.M8Uk[0Wd}~Ǣ+xTgiA]>۔4QFU^P|vu6h9oQYܶ,.y=Iy+l8 vX)rVVܭgV ϱ]bz9U{ƑJ3 f{_3߱~V܁ʱqcU(9T|WC]_U15fQ`{9?QC>܇*޻mMضfV|ӿwܞ+|7[~]lؿa+xga+ԏk*7N<{9ZU2}{HmǷK;8ZVg]T]l則㦰= q(߸pk_boֶP{esb}=w%|/{/(7Qs%9(;N f;#ܪκ_Ԛfo;I;{ɹkፇ~sm7߅=洺uTiaN"Qnm8tM}PLPh,*ygs!e]iŴ'?tFp睋xXxXl7e{3N_݇UL,|4' ǩp0?i?iXF6lc'A#q-NF 4HӲF[J+c,zj2 k8ȉ CZT{bqXfb =Nz]~:F99ǐ/b_:17Usy\!߲+;˫syvq@g[5ugm 5^OWkRiZzo҂cun! =+λ.QK3 hsHC|GfoEQjfޫbKӈ\.r)\HS"ƔRȥ14g& )^??3w^{{Ϝ3RPyHQ,ŧxC$^|eRLR(RL rk Kx&*Q❗byU>,+9J>HȇH8+M NGȐg\"x/+9r-!FBIA(BnWV*M@){,ْXZԷ[ֲE)bͲ\&WKj(.OH~銐ešpG&_SdTre_bYJ꫗W&%.Pt &Nq̗ֈoȽ-mV xg_xJA&e7te+ܫ48((YT/¼LHn!H& ـڷb?ÒYI6!Yx;)E;NM8++>ȽLP' yg3]g'YH-ZFy d`oqᶠ ԪgOƩamܬ>ڸۨ(w;k`>vš{mlagb.^ish,n忸>9oʼJ-'ie,_,EyvE*ӕLDsG㣎鎏*}c+c6Oewd?ݙ=;V6iv~]Co}b}=$/{_}{yy/J5Z_ѿ]zhED[?9|7%F#&8_LB {g vJV8<gAk]=<ézGc{|AύJSr;䡛ȍHJ)Reo}AZRt^A 9Gd!r/ʤ2H.'SSϋS'?ERyRn5t}6[VZ/˻hMK.ZsrsH'|>WDž5qר5kjSoGkPj~5̒\ĔEnSTrP"{¾(v]VOԃ1|JM,~Sȓ_1dKaa?SW&P=`kYF=>XrɱJ/W (rC' p~Z $J")p$_(qTOܟrz%oyOyx=;<޳HZJ)5S,^3紇>JQGRrM(^0Dh5[D&j/?N(=f;2{υ]ջҧ~%y/ ]ߥ$:},X·$sߗ HD\{D(RRMS>LRDž~_> EkVD]>#\]KDU/>zQ">zuYȾ5HTe_Ⱦ(jrB|wgEgj4)ŷSE>|LG^1Vzo!oxP?+⪸..8-QZ'vHĿI/Kgşԅ(>"]곒U_2_HIc.}gjsَÎq::3!Θ3.9H홏d32$3Ye(Sd4|[拙=/g^k!.;3;S~4ۓ쐼&%9-Ɯ?e?wD~s{߹~byJPSN.r(K7))SGR1ɩ45%SNR&]s(ͧW/rJ+GJ6doIԚJ,TEi6)t:~4`^, Vs3zs: x6qSײF\GKӃuj]ۃkf2Yk n5`gpgpOp_6<6ƈ#{ÁBV 7@d:+!^ i!S CqzaJ 7ѻI?zi\z]CP9Qa%`ʨd3Q1m -2愖jkBˍP#7жvҙ+0 bLVjBC'CBgCK4ȤuXx5t-MtimF`qZD}ev3-3a m7 s<[hN0')7n\Ҝx js\At&XK&so!=mfC`E0æAѬT/h,9FWkh6ϙySsH'}мl=g 3dZ3y pTcClWl/Y+?VNi6ŎƎhl$ͧ dm=U :uQT,>+.SӔmI&PbWie q9Uw=FnP#FZV5Z@fض2[NZ##g˥;5$_A)wyY;f=s7zbCb8қ{"2!ڞ{&:Dy~Wr"H$Z)zJ+x}5{4-g;Io73:.c?$i|s֔("\ <xjhvbl327'nNTcm7W&[K}swbyAZk&3N4oHl6$)vqwbˤزg+mP$؞إ3^<+?XBڂ@1r Ǵp^J㍰Ek>oY2eC@W(2k{;p.q2q*q6qA&.%ZZxu5.O("bf0*0f; Y `"hXf^ڸ^vu]YvsYg{. N sh<𯋃:]un=6 /9y$I[e7^A[@@I۩Lm;d,l{Cz>2 (m *o"3q½!dN`c'(UG޻1_~| x+z t6lن15 _Ǽ[LLmjy(d O&166;ؽ#5uo?B"dbPljf:p~~ߎ]ʅ~<Mw3k𛂹0:?gA hL ?h ԥ7q!f溜wBsfט؁RdڋX mNB1'"jo_$x|-QѮ%hr̠fD #ÞM0T#wpȮ%Kl g} uٳmyh"p7r"4|IC3X_vd#PطA@s*ZmEl r3f 'hxf4hpgPˏx' |-Վ(2J@B { AσAA!X4Taca? x-~'t#zs8~v5d tm!ދ`e)OalӶ}&pfc<dbvO3qkާ@D>\Ven@-*}RYۻ@wS $JMÈZes@-X,ͯ[wG*xq=k c"w sh_=fǯag y ݐ}@lC!h{aF\g<_^hkkk)ÎB mQpA1sWXjG~9YN1ZZ'#(5 NJ74c'2>˘w]~ߐNXaL;b"{{8)O~5>—.M'$ӧ62rx#|NjNAk\8G18lx}}p۔U;ϷA#k^A7u׸uP _O"хqf/eksYe݌24RX>gOy+s zUĮ96C%Sg)EK^K*D.?.߇W_-Z+F^ A2C yMF !)UR4[X:GR\3}#r3}i:B'53՟njn̼FЗF)pDžN-d{h︕qfAs}wUBXڤRc6 ~OrOX,&%+D|U|CL3v;q }*KW\ O88'f:oq"sMrY(>,rb1Y,8';'=r)igVT) zWD\5-wP?w})bD2mw*י*G:<47`c{>S"SgB䈸]z?=!?ҸgH?gHtw<'5MxzOӣ22x&$ -  }ττ*?3ʭLRτ*gB "+}99C#[ug};N{=]Rw0C6-*7+3qM#Vk9q=p^8NKu7cvS{{-տvD[zkZIi{i-ݛaW /el|6nqNuL\.Һ֦'?.:;;bt_t=3Gi y}˼um9e;gyܿR>նyw_yGѶi[:S96ө}x?ݎ4GPG?arTaF_21=qOgS3˿An+ʧstT׵v5Ѿ~[w_i?1rJOU==sxn!?uɩ9Y,,z=+= illlIkSc6F99 ^:^qI)Xz.x.ka:+{]^^˛NNNNNw/ YeRLx9cj4׻]v| *15:^K)y-޶t vxwxw{8 jt\Jב%>C}?s:==z{sދ71!ؗ锒}Q\2_7WK8 ө}y#p_W[}.,6|f:_v_ooow;;] k~ Gb{C~RG]GqQz;oZ)5Oޱfe9+"ww;\F;-0G^Sfx}F7 oǢ]޵7st}kuu5v܏/Wg /420I8s8=s.e^0hvӽwJ Q6c(/RoA2 _2|18=#:$/.F2jT.%{6 S$u| ?عC[4c;6_|x,({7p:3T}9svް'_?F]} Pv9_~Be'7 ;)a>>W ~^r/d}ݰbxDSI9;yϜ9̙颒`/Z!V{F`xB{> 6"v}f1^"\ _=`9[ ^p~=>eKOS)߰ V;Ýu)*wέq7vwIwz:sO9])^7zzW.vz%^7] (7+)J"ɟWA|o7ۛo-̋kySVJa7R22&)܏{eDӭ"yO{ s9Gwaw绵qpaA :ww{gn7ܝEO2pj ;Ffa*@躚2T ]n iwA!?M"𓳐ݐ9d.'ɟtdJITzRd8ҟ>J.B`9X7En= WUF =?w=>?DJ#Kn?Kym)E*Cz&^i9A ?(>A?Q0[$ 1P* FcPwB KAqT㽹O ΍Oޯ ƧdJޣ7.ŧ㕈)ωϏ//UjF1OP͈Wx~PHK^Q (g;G${.Pл[at_ 8m]/ٕp/߯Fx2>앱*#[4%f'2_?B<#Y WۆRkbւfᶂs9v]X%=xHt٧GĀ=5r17fB+mnj- ?gH[rDtͩt}wdxKp,S"ӐlXM`HUؓ.ikehZt+]̘ЯG^f V"CAԟJl9_Zɏskhx3xy ,>j/79թ35%&v ꪃ6G.Vۯփc3SGaI ;" J|(#_Tnp/fA_>;ma3]K_Ì!ZVARKע AI/@xSAx4R<>稾1ejb59F x>ڛ# Eo턅q+bwY9aY#sX9s2 'hsmG]L6fuMעRΊT^sWM0w#m9~"'vEbxc76#/Dp, 5pg #[[%H&o4eZݼd]쯲KD>Aa*>ыh ex&u я`@Nx2xEI0Ƅk3\'L#$fisSa[@8ȺL'Q1.3-<&V3פ+`;{ %8^?Zw/u?־.l[-=->8:.g|eq{d\[2˧13k}[HOI߉Ӧ-#hА4ѶNH\6la3%DyEELWW,2($'5ބmq^i*iI3o`F=1p+ M۩fڢOF?b1}7clߏ͌o ^oelk>3]_!y"7Oa[Hw#g!3Hrwk o{=@A8ĬO_seȗ${~RAx >gG@S0i҂${!א"P@x Yw)pkDXx>0rNyxjh Ŀ?A ]O'y|x+UkVx/)'OOw˜_7v B.&XFPE`A &Z;Dx>Hψ4s"NGhOs"x^(0ςa9.0Թ٠@ 9X#9^Nd9MHf!\@.ˈv:U6Vn;jemٓXgӾZ%yzj yk8t> 9M?-ɳApމ!Fbsꈶ04DNbg7>hS |zbA:| b8"ן?$#jCxIDˢ8go^;[o}i|O JOPh30\ 30so H0x;7-8n;>qC-#lsk.M׮ '갟:¨\'L5\8MM& x08cYyѴS4g72x^(9W8\#_J8D3T) W-UKEIwLJ ̰k.JN6K]XK.nCZ:õ%ut"z"~("vvWa."c{3K7X?bx~CEO*0v"/] d\]2W抑2OʛMb||'yY[ć&&ayUoowmb||||/o;=4_-&5r\+׊<zQ.e$!>)7ʍb27{fYL[)׊r*>-mb۷BDD|VTTLO'}ggb|J>%>'..f____J++kk1K>+߈|^̑!񠬧w<,-[̓_ėrʽK,Z_N4$i\|=aeFg|BSMEMٴ?#J15P|ZcDy#ABܕ574#JNӌ*q[,2+z^sELe9fL3i>EfEZjM364޾Y5]JTy%++G2RϠ:F{,λn'ͩ&d9DzHߜjb-\˯KYMSg9'HߜjRS}2o[E_XBLZ+ݛ^4f4Tֺo(UnjroN%ߜnZֲoN"k6lֲmN7=k6/|ѯ`F}.|ff//xuI*މ]@PmS?V{A'wƟ,EA(4B(˨MM!\!p/"oXw;%5m*-e2hid-(7kk]VC3*Rw4 mz}T=*="??/r鞧Փ|' ճvAAK1~n15A`EE!CCE0$ţǮLT$tKo#]w˩w}FM] ® }N  `f_/ڮ_A*u,c]oJ%>u>G}'X0)T0=/|.|!~6~芸Y'NS=ٯ~=QY$)~/jWʐ^?)~ " !Ts1> ?!,sMu?G5-ygF=Pgw5C\qʷqcV0Ђ-jG3SDcIeit/kwuuT4gbH׽U^iܽ/$%tGoYꬔt)uFq:{!~?`?wVDs̟p8GK]휠g݃N̯WS_5&Vkw{6ku^B?FB;"6k2Q69u"9GA"fAQPYDJ}L0ЙE qzc EYhګ+)9 4~_ORH2 bvAnX{|?sj5vP)9 Jgn8(0Gtm$?2~=S[ q;|gZ_^HQ ?G$AS[+Rq3?7Gm-f=>~OmG NIRYX7YolpMj˷ l$ꃶhƣ-1V%m5I5wU}sX|jo6GҖ{6lӈ׾6_Slt~͠So(lPCm^r=:u<85Mi߽6Rե NFӶ OB#-T&RlBUH{V(Gk1wQXZT.QvQ Ѿ{yw'X[٨bֹ-Aja:i#w ?ocKGi+,oh+oFۧ>]e͡ޣ;L@r>[/ff6,)Nw:O@y}&tvZw__ l "][Y~;^oeW_j7v;$l{%$LmlBx>6!mO;X"eG{tTg]ΨϩB{4ZJG)eZX%݇x0^} 3G`}fp* :)^/d<*4?G<RJn@bUJ@5D WXU&ϩ$0?G E lj橅,bByBYah,ZI5fڠ6DIF=u\Tgd!^r6{LS3q"sQE;k͞c0E8AT}﫰GVYջxRݫz˫p>!w68@nv3+컕z=[8cI?"#S;eXW!'f=?4[{^w= '<=V%0}f']? w ~Q<+)EI!RԷ3 t_"lꛪJ=Ss4excޑ=a`qrouP=.‰EƍOrb=P >@"aqWvs4~Wb֘&sNx}>a;NF/X4='&n<Tӻuj͉"UބƍإwH7Qý-u㑰.~[8Kt+-b*^**E4^A#ZQ-6l6O]=76F")\DoD"4ֈ]Qڸ"zF󾈝e-" cwksHOD4\*=s|_)1=AfI!<=Τ;lX(5L)6ѧqwtm,Fmi3GJ؈}_nq }(SfQlcN-fi.#m2xR缴UWGt7ܮRO_9Jʻy#)~WtU;'[ѩ焙#yitmƐK,Gu5 !/5W>g 5h`#躢I=SJLo&gŌ[qVWƘ6ἲ&ִ|4«MceddcMHV_&a_#,rNt؎{.L:]G윴n9<,; `/ D[B0~~|Lj)EP10Wrl:3Gx o8A^FzQڜl1lsP^} 5d>-kA lfvP/3@X<%|A UBKQ5X S#5^MT45C2sX-UjZj &UK4[UUVct:MT,JXݬ*JWj XíQX*XNتfZͳp9Y %rkFQdɣ]4_MːO' :wfkzzz:h^['3yo5ڶvOofR =ӽ0fѳ9͊{7Y{3]糚@fgҾPY{[z}NYgN oo '6a0zkAϷAO/~3Vg@ `-˿ F.i ǁauQ{OG1gNk 0Tۧ_A<LT+VۻcP->4dݢ''p>Tlקzҵ@wL_, 5s>D{hOrHr9EV.EauuBEn9g6Q{"um֥KK]/͊PzMuTP2ꁍx-بCTϙ똳\_׫C,Νp~mXZ}~jx Fڨ~8:w y.'D(!(Ɓ Z;z96ޤll_}!XGf_">_¯)šJ.0EI&TUEDsL>Ӈ`[^t^UrbT.)'%̗#_>p%#3B;~"pM}94>p+b#f9bz"#q'"\ <4&͈y |/s; 3Gl.IQ8#5~r&WFwfyrar7񲭿9Rk#v仙ڬwYlfz.ژ3L}[24COװ&l<_L&`3{{'%K9\Ti`G{̑5萑􈡯<ըOmOQ5Su W<1m Wq7hR{9G vG-Jƞ'\6\:GM[kW"-dbZۈ#}6P񎔜r.h!%_uJޑw$B7GJk)Ys#;;W9&wV8[F\i}TQ??C? OT}뵶#-OTKEZ)٩`g㛦1 vTkd" g7DY`bOwRM B߲W<lVt7?8*YR5Z#Հ!ɖ|K *}ZҟɳOؾsXXQ8XjbWJk^cXV-A$JN!U%ꙍwwF8^};ڮ(` תtk^_ʚ:W2f>mKd|N[vXZ%Y|QȞNEzIK{P"jMѾvųؓqkۛ6J&@8It'HGy'K=~ak}&^4Kr`$ r*O7}fYcݖPֳ"L (]qR>CX[YfکM 㝞c/z|Խm1z›-Vq#ȼ2lgg$k>H,}xvg̈P y S33323#3R"hffffK|}ՌY{=J'zgKJS{Ȣݳ3h z[⡇qWjvhSd_%~C 6T'ugԈJ'$Ā½^\M?I uZb$ 4mD2Z82z 1-B"Z$\E^ Pv)|)#wx&2}"Uk7!?]߁( ZwDn!!Bl1o=b4\W i_t q wUCjO!/U(n8Clś=V *=/xo֬U|<8UTH/ N_~$8Ѯ\GDz2?xk*?>11[B璠EWX]ʺT(뢬ZUITWAeŃzPCIيyRcZvbT'H"I&*OJ<^qu{䶊U k)!ʵ7`ڢry^HlC vҥ鴡K88MzataUVV8t+ˍKԞE06Ul^,yDZ[Dr5F¬ǭ'֓֓$zz\i7qr߀4!MU$4uB0rCS8~) b曅E҆mMxڅi4#:Nr-h!z\mMЊރc JiЄEjFkud-M҆j#%i)Z6X.MҦi|R[mֶkqpVELg6"X-h7vzkhdz֍L6GT\6|-g:YЎ_-y9avӺ =Lkz ^}=\D\y[bBs)ު&ڟR&h΂v56g76{ֲ cV>c;^ڇy+o6-x<̻$ރ}y>?>>9|<'\>Ot>sx>/ [|)_G|̷ms%?O' j\b\fT3"=(Qۈ6hb457F71ппl]v]׮o_o7o[ح;v';Nv#qD Q*NӮZn+*nwݦn 5w}}]n d2ف!ДдЌЬ!Bگή]Ϛ'ؓPOgؿ'b d/?d?)+C+(oط<-xKފP)%(7*/W%xqyJJheL6Y#l`7b Jp/_ŷ;QR5]븡5n=:{sw-rWݵ:wC 5/?00pυ /t@ЇC }w{_`5Yր5f߱E_{b;XV`C/l?#ؿx{ޑw yFB^K-u0î|"^>vr߇:%ҠO}d8Fs_ FQRS&! I'Cʾ9KS*`39|.v|+/ 7CDu#`17Co6b սh =q'qSϸ3#co57Bk -GH'G!>%NrT#pFsmg=z=,} -тrX8^v&7t2,ڙ%xͯsu8:ek+6iS r6fɻzw]~ƪd-~՘ r\))cUʷO}IXccIgXu,ԺmHZjOWbud1[#WDw?d*r{^+n%~q[_'\ҍbl*$kwNԭ;uFMԽmyoGz+¯pk9#O'ݟݓ)'W擭Ijv}B}N|LѢ+Z# h$&"V E3\7fJ"Z[Eqh+nqN)ڋDq(^I':3k m Dpđ'BT5DM%~a G" BEq*.a2..DRD֓G`G͕yB,uq:r9vrgsg3ə:;S΋4?t g3)p;gSt^rsv8;~ s9|:?:B\O/elDdc-[VUA"_ApH~"PԠQ?uKC%Rz^AiMz^Cб4NS4:ΠlGй4B.Mߡ!t -v{~tnWW}.hϠ#QғϞr ^ҷytCoajCT=q8"W_ouog/^ ]|]^ŻAUu?RđrC[r;Ė;)ߔzn@p/~+>PGvR?C1I65dyۏB]'#z 3|B h&G~N_)4TB0NIk(Z֦Ѵ.}@_3Ke }Fu}E崈+*k:nV)~Nw=t=`ZYn@Soj)ԔX[hd_:s ѓ|oExGt+ĻG}آM1~vc3bxZL9bϋqb/ω b"֢ĕ䤺x/'诚Ю9()g3y\nC~e{y%dYR;`*t9!# /F;c\[>F;"Ub!zdޢI G/1{.Fh{gB"%/]SC a/Gx|xʋ"MX./~ĠEt1L + '7Z]; 5˚_tK=O$8wxce8[#n1A1. 2b%.quYUQbĉ)fT+UB"zU(75!N?@N}|? h9g/{ڗP_Sg!X}ې332K< ԑbʎ{3ٔ߷[¾r=`oC+i'vj/s]" gI|%l|??;y/t'\ΰQM卪oƆh3ˎy%ֶiHmd,,YZYڕ_Y5.3&g<\pҰϛy, D4ům\.m!ž*?纄,r)nU 癙b|v=? <{ߜ꿿׹^26Rbu*dz%RpV,C=gh喔k']GGOvBլQ4Zδp6_ OMz\-|=燔PČd>u,'/?jB0gɜ}՛G6nQW>C\%}>U >V0fh:!!ߌXNV5dJ= 9B4i 0*Eژ6h[ڞDq`:chD4kƹUr!2ϚBozЫ=drR=5"E(_M,g7AjV[DR ՗{A_`!|AIi7_+ _`/_ `7`o=pMA>>h}}~|7}|YY}ـr `a*">''5B;;k'KՋgu?U'Q;NGC@.z7[jmZњ9Pӵ<@[i ZK;J`HVŰX֒eXgRX̆Y"m`l;ȎìzKA')z>Xs\}"}A/wz~\0k[̓x p>\.CuX!0VXK#=7<1d Ɛl,aX6a x\ zr}xN  ~ ~B?|N׸ͫp0ku\7y3 %oxp"SSx:v*τk> x(Gcx>O§^r:|/ʷ=~'4φfXaUF\ͨae5m7K-68p{#Hl$=)F:pi 6#ccc1x1˘g Er c5*c xegGǍϦ)JLÔ}||puuNjT_gqXB,u.(9,*Ϣ,*QxTC9TCe*PDT&2ILBe*QdTrQE%QyQT*/*/"*/2@e&*3Q,Tf2 Py PlTf2*/2*y䡒++Ae*sPyWQyEe.**J>*Ce*P)@T2RJ!*:*,@ T@ Tʛ"TPy PYbT%,Ae)*KQY2T ,Ge9*o6*oD=TC=TV UjTVPPYT֠!*!*kQYZT֣l@e*PوFT6 MlBcT>FcT6ͨlAe *[PيVT * *ŨRʧ|ʧlCe*P P lGe;*9*@e'*;Qى.Tv ݨFe7*{PكTCe*Pُ~Tr@ T@ Tr|ʗH,1Kd'Q;XD<݌B,=kDb.tE+*]QID%DTDATD% $TPyPyntC*QJwTzD'*=QIF%dTz ^J *QJoTRQIE%>A*iJ_TtTQIG*PJ*dG%LT2QTJ*Y De *QF%lT[|-% `TCA,3C?'?FZ?FZ?FZ?FZ?FZ?FZ?FZ?FZ?FZ?FZ*E**+PY TNrRJtw&P?sXF8c uQhAHkR(iPI,t"TEZ%-*g|k{yy/K|B7DہO\ \\\^ py.=.= .B\=5 f2FGYx >wO4BhЮ#{iȶ6v" B2OU>ȷȕ, '(!,OA$A¾(KFR ɂ|0"Dv/G@v{>"uQЉv d$QE0 'gQ@|ɷ 6g6A2M'gvl/30" 4XHXELHLHLHL~xrlf``8`8`8`8`8`83pppp;ۉDAr+1áE& jۡj ۡ=4 loGYwa;S(zɰ !="A<0yvB?s(C?,"N!$Y TBcL6D4mf"u "~VE{J_2Ex AGj?*"|<( ϸb7ɣbn`$[R /u6sj8 54j>DžHGYVcC!E=7x"`P[oڿ?kɿ,גMf s?̅+aQs&y ᎅ֬pǾh# m1|l@ +!a @6a{ʃo)C6&Dz.tnG8z]rCE ȕ _V DݖN@8݆ BRt!>9hz|Y7Ys?1y; g; !${-ׇ8=ϗ:@jWgw`RiD @$y5Z{ϳB>Tʛ;%>DmZH,7]oɽ940b֘BGqM *c ={ qXKKȍÊXB_I4 n%L`oP_» B(V-V#vIbbĮՋk@~kEnNdMN+cpbUj` 2 *x X6}ѷw~G'DQ0!ɟ\FIEE"Tl7 ~9z vX3>.IW \?pW9@LGru#.VC%W:bwp+習 #t<"Rőy>o'$b2m4SDĹ{CAN>"=N_-bbMb}+0H@> i)4r6hܱhYށKR_!ǞܙJ7--M| B'0 CHOhJ\ְl 7kQ;E7ȱ`:IBFjAFjAFj-0ÔӔJJ5@Cy^#??*GP9TjZ3Ah8@Wzx*| =^"tuz}>Eh?}%I`Ҙib:!fMc#y`~XW-ہ`1$sunց`}G**LJReJTu*ǝ;^j5;HDMWL&7IT`%,`6pp7p0 < "a`1(x3xx XV/+Z5`:xl6ooo-VC`1I*`$IA t.)Ǯ@7;Ѓ|{>@_OP`} \ BK ?IBj 5i4HM&4 +M%+|v_{:%=݃LJvcT??S:9f;[r1 U`0-;PSa{Dd⹚ >gν9J#A`LO6gn`F"fe (¢B|b*͇*mRYl\Ef\V76 % 7A|M0uzZ֑0k6mYl)M-؁, (C9b-8|G bbs t=#sFq1Q!`ŒeHaƈYᡋC}"CB#;qy<Ɛr?[>=8L|2.7R57 XzFġ!!wxH$46ƜɅy+L0z-]Z,\5WH_鍳)JLC06(BA62=Z~ny4]2` ;9C{cO0~٬iv5[ӎ4[l hIc7+=p'Szp񍉒"yKZnU\fzZQl4KV I7(yV`.V*{zݞrdܽVh`aM[}s\/4ُ|NW'kؤ<[qc,ל%'Wl|yNIмy͸n6E>\RYrޣL]AfMeO1WBUJᒱz}7,„;'_XB;Sg3piYS""&hk{1?34X;,Пt ZX{0TD$2%w$%BO-?hDFF~yr C%#1#FEA%ѣ$zFե]UX=3rµnrˑa.xm]:{.Wd\̹X۪YY5SAGf.gS0{D(>'O2RJKjYABڅxâ,{ g館9㉓lGE˥KO5;Ѷ'Yoc{蛮_Og>>iaaR6'Kן803l :Qć #Ui+ >Ud4l~ yXeھ8O*ycFhC+qUn=`B\5lCNYʅ-i:}*çCΏ2 -`О}FD,㪛143)%QW5 =[RWUWRvaTB홆Oe4iβc:!CCGY:x-/C}/TeW-uJGU/A [ Z.D>&r1JB 7 A98QYQSЃZwEH'*#_g}Ismmv͎jpԍoG;vWOQY?}Vae|S3O.}Q.1VqNI_'sIhkm|[3ɠZ@Zr[|~wRU޸j2}dך0?f yvXqш U%EZbTRě̵T^Hº6i8ۓ2驩#/yXu\vOMSa?ZFʃ>xxg9.uQ1:j:*mvQ7%>޸O%o ֪gz~ӈYGllnQWJքx~]~&m}ǫ{bjOSE{mcfkZ2%& |׸P:Yמ`ljv:UJͱqW2$՜ܷ*WΘ k;l=Yd)ۤI+n|u"aF@]Ot5XWPB[TԣE%5  GJdC T7BC Id]OoK"B#Iz.KG_'k:,8 G}gvPQm-2Gzz.}+wUϯ^y(WLV)Ͷs\p[HOur^UY祯fe>ޝ}Vپz㻩WjQwo „6u 9v"1xȚyw+Ҋ(c >gX}iMvUiB읫:D}d FqΒ{Z; &"/e6O)=*+Z&0 Oo*h{#8}PGvIoY:J\_h&.d A-)<0>OևO[WMȡWgϢ1#a]9cqf]=Ekwc&=[Z!"KI8Xճc"I|U-tۏk7b>J^ouèta'o zNZڏ߮N4F3_G9 1kWX=Hirnҫmo;mݳ/BEU~۰\dqq,ߪfbcw} _(]CIּ]%&ؙ,U\:vzB8aϗ*dUs8V`6{l3uN'U/.fjU0/CŶ՞G'3mDg.e c>ƜZULbso(ޡki˫Ϧ@,Lu3 .qHTs ?S X0Fc<p?o_(a;2.\\y)[|މcN;F lw=pPjube]Ûh݆UF7(,kE֬HqS *aoa]saa͊5c SUI,}c:\q)% *ؒ<ޚ .ْ/-N7:7˓u}O}DoDX},z:y:Ÿ},G]1O(Zi9揇L}ӤhÂ'kmVIdk{겢-2ʹ}:Zԭ&> ʣsMUk1o(-϶,CZNDٮF]?gclzISM}x"<~c3eގ1 1gABg~ljl.C}orG<\kjL $ͤI6g[VOY[)4\}v7!}Q Nn[3LltW*Lyo“YA mg'a;ۿaoKF RE{d ⁘#iWey[/\~P~ᛷG$ΞdHMzeK{9 -ǿ2N݄mʘC++%iLSsM罻bGB[}=j-sj/:_`HkEK%Ns~4t bykwvImB-NMa)+_=Wc:5RN|ݮ];cbYn{?M9Վ3%3<[% =ZjƧbe% F}?ܼ$s6gb*eG Q,\d~ߥ= f'f]hm9b±w=pn1C42M-ԃ(m ׷dUg  a,ށB/G4{vF*Pm{kJ4+WiZx-TME;dUGfA '9vC'r`4:_ݝDgƪfv wV6S$Fd7N@Id׮,߼YƚebRұkΏY8CS\҇^:V:`咀CgO>stream x `՝4hݧeٱ˱؎$;$6q3[JXʶ.vnJ)gz.-{c+-Je#khF慄1V[s[OÛ.׬{ eͦ3Z?zp>ך3{~`W=~`o|#Z}O\z?{@SkUM ~m[W> 0?yßgcc\ѧ> lx'r%}el弋}>\f{Y سkt 31k g  w]z1ߨb.76#, @t+{YkwQwxtc+v|m.<?ERo\u {#Y\US/>['ˇ?܋0mƤ'RXFUw] dK&}? @fe7|~9,ku7LZ9Yz?1lj2xzm Y*]&u6N-͆4KxۤBs2 !_K^{ȺL Oa°C`"t H!Lagؚyðn4 1|_? w^L߆Ńn4 7aX>yޢY,󴶄>}le? ا= |q Waא| 'kq\+qZL_aĥ!a!-aoz}ORdv `XC\4nKiyw%NCm3 Sn;2 F9Aظ`0 `0 `0 (o|:ؿ- \Ar[`070 0<62;`~rL7c|C_^+a;aYU-a&@z7i\`x p;.o9XfXˆR _k8>m6M\Ml`}RFw_6~n~}Lp ӯMMe@ߠcݤXwbz=q-" 6!TTr 5kaN%1:&˚A>J$g}_n{ Q O :F< F".fGhE`|{r8 >~n1Zk},vɀ1hmnqz!0O.]e3 r,ƍ*FRTe8ʔ`0ѹOlǬ`*j':3U_Ns9HdN5B4--u:]SӴfdcrRAi(]k ,m0<'gxr ^3e̛`s ADU VTUl ȨvvT'8P]Dux7/x!UDP/Bj¨5FQ_ZƠPQPuq FI6Au46 -Dm&Ű(߰j4C+j,, KPQ6Ў:PWB7te=ЅڋGX Q`j?̼ku-B]=n^`5Пy6R=֠na]G L8u+ճ`#ya6ԗl،0z pfp mlݰ=;88|x[p`B(^؁>ag7p BC'kx;p!ꕰ]p1껩.<z.C̳pTwf»P? < )xu^̹i~ԏ?ހz>@\I`)QokP? bMO?Q?̓YfsT?E>z+܀'qOD|*8y ܈z|_ 7~ +YԯRW.j>:([Pw3<_pa_;P%܉MG˨+߂~;pWa.Q_ Q2nz;p'pT{P@9GAx|pa8#m_wP>Fq}'Oi3cg>>~x -P?//R} B<^_B¯P Eoß ?ÓO<:7Mx5ϣ1ԏc E+0nژco.bL.;_zҘl1Y:?;mL1:?3?=mL?NtL?>_iLlLsc\>wB٘c*`Lq~c:`<'I Ҙ 0F$ &zQh]qΤű1*yaR6Fb'Gb\:\b`T,iΊy) `A;RcC&Fdc&j f#gTɨ9#_Ax`{A0O/}.Qك3x|[oF !曑lfHԬ$hA񤺑'S`c /UoF vR J1{D!oFEYod"'W`ofꌉfNt1ڂ7 ޠכhl-lyA4YDI,?#|f.+[I܀)r]Mm,|3yIGC_038_Ίy'W`0+ŧQ)11өlb-FQ2LLF=o"D^c&$an C.QكJ7c͘hb$(YxlH-b33ۜf01<.g 6>Jxpκr`0 F/⛩X̏ȴH*l6Mdlp`m.XjEw]KJ flt1w\!Ƿ󐌂(e|&6b3Zlݦ&٬nJ%ȸCA/rU@Y+IGcgŘ?KY1r`0 F/r$j)TaLb)A4Hde2$j,6,L$Uc uyf!}5c[dpL`#͚E;}b+nTvfB?eV#`el&IY)0gKOJ1{P}@l1Y4v{nkV܎{Nvbv0Ba-!{mro5MJ1{oF*웩x|>+3=/ Sn ȃKLf*e;>+I9o&u~q7plNG|3r9ӜJGZc0f!E  I%Qtg.A*hv` SA]vj)zCtۃv{a$41c0U !Cl}M`0 #dQ曙-m.̐nTa, %B6_0-,#7'؃^q9*kdXGHKGZc0fAo /$ɛE;Puu(!o:`: ^zkz66RqF\FOyO:?Rlb`T,38_21m`0yS'ViUׇc^Ua%/o)`@t\Ձ7έ6Xt}-܂pi(]k != VMheZe5J/gi #p6"yÁX6\H8@W#^+V #YƊyyIG`crg038_U:+r`0 F_b*ɢc~A'UDjثkW ]`(Y\w$T!,:3*@yos-ҵ`Zvցͦ8Pel,S5kmH>RHK$B=!X7DgBchzIZ"vQoV1gy |̈egM`0 #T+c`( I'UuƜo%*B_ K6ꐿ:ө<3v{.t1@NEChNH^V7k㘪mFXj Zp=GP y\ӳȝM<檚IG¿ s8SgżCh&0 jřKnA}5c<=>.3E;W76.Zذx1־hqbL-jI46b5X7y)YSEH; LxcXS1b'umQ1> WSgżr`0 FPWTi j8- 5ll/\#v2qrnAC&ѠTՅ5$b L5ĖjjEwtCf'܂QÆ;z~X,?Z:%k/ollkilkܜ$qn 8-*wjcθBN{<ј5'j"ږlnhN6% uS,%}5c0p zUB!X y,?Zlojo]卷'Vj_>JLƓI_2p&kz7ٰ,^`zY½bs$vQ%ނB?JQגSgżC&0 JyzE>Iqa)"̍HkȊpM&NɰۑljnMZ]M]mɶd%كs ݵ[2CBtҵ`@ C[ f YYgyڞ@ry놞,_ڳ;Hq+&[[[]&p2ڸqzӳ5*0IG¿ 6bNir`0 F_;-cF[[[/yQ-SalqOo߅}Ѯ5Quq{GkkgDҮ֦֮uMS,%}5c` P$Ȣ9%w]ۻ|PKoڍX;ӳw@GGKGGU{#-5y,옞EO<ϧIG¿  6 ]|Sfú6`0;?3r6G{{R[Ha˕@qh$2]wAj˕ݪƅ]۱6y""Ys#e4F؆-=#EVTd(AdW:ְJww$t|~SjU# ҋ'Ncʫ@8jX>O'x"B/h ^Ҹhtwl};:ل?!oua&6iivBwSb8͍c%3IɁɒ#Q<;mɊٷ3]ZۆԾľ0xRJ+ȖM!>Mĸ OKܞLCRZ?#=wLxTڟVFj:,F"Et8 Y.N6af3qrzI̓R<6 nKēP:\7#"joOf gu0Lw.%Ӳ&'U Nćrt6.ǁ.ꏪ́QUp澝72ys]00=ƅQRJ>tu4{pp4#Dvᶌw=Qݵǻul:Ų#**h.GrI&I$tkr&Z?x- ;gaNShGd^+鞬cn0ĉP!=ۥ&K O&Jmdzij{jtxLBô&j;nYR dt81A:L$Iw Yu0%r˩DN$l2HiT{~;J, -#I_L_4V%ۜv'wҕא05ch"o֍E1c=fC;=HN)ilW#{yʼn1AC6D6'}`:2ی;; Twק(76i۳ \p] o[0-x{tW irk{بG``( T*|]X,o":|MҾrtւ}0Vbt_"c) {ʑRU#8گҷz4) Hj*c"O{9o_Bl/MUKiہdu[QdbpvQ$khpⴡ|ô0gxxLwܑp{ڱaAܱW ɋ* >S0?h 1p|DU_W\>G9-F^!]drt._ 1pSITRb؇ I _ŇaeU=u 21d0h{1 `0z$gc8Z{~m.]pQ Mj䡳雵uZNZb-;٣-jKGY֖c<7҃GqY0ʻ!9ݼPm]-Gy=xNgV{*p/C6{-s]bg44;N9J `8^`)|== 24aX\ `8e =N!6ǚ=pf=*sbQQ4K[Hi"MDr4U4Q_k`5cxv>={HMo]{!!P1l0a?#p n_F*k{ߒ%yI4mBn)%BKK)J_YDR)RYJAY  e-] qDъ32 UESEAT|${O;s;, XPʰVq,`cѰT`1q0=/ww$9Fcz6}Coևqz'fO[B ވKV"ī;Uplx4!^njG0v +_Ӡ @Vԁ| uǡn/B]겡. Piz5z3\oʹa{`>6MGOG*'Do"2bȩ>f4*}3`^'^G1zya]e #X~"!vImXa)2 ,?`tr~Bɼ8/qℏ"+k=TRf`_G;{,\BFM7A 7˝ (yPBR/"^o/}ۂFo%>fk ^o+jo[o"x{@XF~9 6wqu%_Λe9^؍kf N_ jq2Vf?I^HlW4Ӈ= 0SB,O 9]=dlpTՠLA2j pەɒIൠ*5 4$t!0-d́2`OYCF؆↉z/.'!ʻxA`_s=_UEܮ;eNuS]/{ i ț`iXJGCQ3x$`y $[6u<8޾ڬee8)RԦFlUG8]ua"ϫ@(^HQ*/Qwgbp ñNXN#N>$AULX7e妆y`-UM72VeNpKAd~{P}dM֦k 9uXUӈ~ŗ͵k~3XkD.G\|}.z}2jXD&ۛ0RexP{C]jP24X[{[ZUoJ®-CHhE=|ְ_-~k"Xo7A:v!!#zP>Yޛ&Xg;B}h#_or-@BR[|#SBXq_Q[ &ƈ wל( š8/ؓHm%]άP MXneY)9ƶ9~FFCl日aĨU!"T,i$UC7X62+z-f8^E,J gALxT5}(,ydv3I#^(dd(BNC,uY@j3"d1 Ѥ >|nXʆ(DGKLBhqw[H#ُWB>E<}6z+5f.aΕ2䘈\%%xgy'*bKdҗL@j'rVcU!Ċ|ysA4ȃ1PIs<- /^,8(BOgߤQ+ yC="&OUHn#p3a)a {ptd5a^Zqxt&21r4тZrJQM??;A>D0p?< `74,-:o6c)Qe>B'zRX&EUyH:VW BHNQsY._,y \|W79i~AaWOk6(q/ Ҡ Qș)0jNj 鴿Kf 4Et׍t:!L?29Y/6Ul!mf g &/dA!$m77dm+$&ҏ" +jy_~pJ뤅~J6hYѻ(S46]p/]4KSDD^y:0̦ % {:őXN҈W Bm ;|* :a8'K:o( .(&ע!9#ҁz|/y 3oQ+rۥ^ޢ 4 vJ LVC5*@?& D>g/"'KlpV 3Q&%N3J-F붔خ@2m~Vl4QrF\L@ N(APǯG+.i0!Z!ۑdRdKt=`]t)|E6]&r7Ǩۣī ho~L͗_v6wx_d)n~-r3FqR^zOG`"3sr<'dwMӱхlzdarACn-B^~!Q7فz5>7^&C)Krnђ(3bv Il0 MNK;KUϕ,%eꛟnOgcA>`G.j"#7 ȋMDb$ք&~J0}Y3J%qP* kl'e_yyAKd2͌B)xm2W|utڡl5M"PUU}=dM¼ V%1{B7ŧ=s2# s䑶6\Í.`&5 2-#,`({%d3#i3~L(Y UyIqRR()o>BMA6Q4+hJu}A[&H9{6m/|q]" iV&y;|-D÷ƧI*Jw\uFFQݔ/4qvZWWs7u' 4O~CKPXc ~ޘ\Bϵ@rc (^fA zeqw FMKpR-TL։}Bպ-9 #$$u}w}db_ O~##(= {:;N bbIA7pFoh\vRGP۰jkG:#I|QSt{-l*!u yiLZAZG5k{*eOCPɩc=s9[:之.0/7o?J?uTF(z*IJ'!s4^Rk3壞U&|(hĤWG<{ݻ/C5= \┦HH$S~8gE?!o(c&r k2u<" ESJ9 n1/ `$HQq]OGO4.^]\"T. ӥ/M5xD>%Bl*[֐_beYJ ySM^ FIE#(F2G Z4hL$Eh o'?eBK/8>P-#|4Rŝ$Mpu{ͨEW>B_BL))jǐԏ k#y\Be>ZUvM8TP341iH|ɼ݈Csa6 )ٸVldڈA tH~WFR[(ӬKK;;Js6My| LA{Ӓ47 -!,>5Lmc{-N k.SwS7u7uTr -Wy8DWQa[:mYFnڧ+i5 CډcvV}BV41/WYQjէJ%2*[#"PZG-ԇy.U-&ǵ^b/Dr?L@[fcB,iJ3[صUO =yd޽奷Y~[<䆤w;/Jbekݼ9խ*R f,63r>LN@*r% A.%=m<:tcc1Gz4T | 𰱮iEZ6$KRL͈ԉHq\8ɅpN ЀQN!Crڠ;@j{01$ h.PE WH<\ts5ZLԺīQ 0N*n BbPvZl\ss-nשKWB.T<+{bW<'@oP&KkDe9+^~zYd6v߽t9N[U9kQǽe]ê;;ݲj@˛3MyD5Śz&Jۛ+-R܁ O"%coIb·H ml#CN5`Lq?W:&*3n-EFYMQ$&&3Z,Ǚ̘,*Af! )LD7 azQ4i=L 7gT:\PYd-#\^$(Q%* P a 3˝>TZ՝z|9f>,:JO KXF&Q "hDт%J%ܶۇ<(1 %xB!JC1_  vfs5}cǚ#E09Dh40Mf;yz?4sb&@Ƀ9 EOߝ ѩpÔOA0*Z(-c4)a3V`nj+05)}ZIqnG::DBw,źTe9Gt*缴qFA|;q@'DJ"i=l 7!pQ|ZSN}֗ 炼8µ~t r]׸ ~|/aYKeeI}dlVW+k-c?PMiGM} _}rABݰCݰCݬ@֦ ؀TwB w'6Aܵ XhJ e%*YDpjNfF<9ogGIAEȈn4y$6Ԑ˚s}tHYpXt,HBI/,Jl'Be=IݬAw#͹m9k\~]{WxyrS;n},bdk0~{ܲn1[gq^tҥ=f?zl;Xr'7(mӮ+B>=ʬdR'.Mjdsh@:Qf}F>C7".KZ/=^_f|oi#ri7ϼuݖ6#sI2ƴ|[]}:p>tkk ̝&ў1)) :q+ %T0 02vkDd3vI'[ 5fe 뾄CIb=+udu]/Wzzv:z{XUYW]3ruIՕ Acܢ%C+U=nH̭r{zw- k{u Z +axPb+,ѫP2j:< hCϻ:&h6b0re1lC5 蕅FIi@N~c쫣g":$mG;5# 8+o-'fg6dr 5ƎY1(BGIAYa^<ύR\b2_Qԏfefԙ YŅ$dfde vOO=r%+֗Nj׬g~Zpz_nk^m.7Ol) CO[v[0 lVuS3#oP':nyr˦!O#3wd>YG_g`o};{¨]n.'ډb\%Z.==0Ombl/vm;FeOG~SD?ş=J.uJn+qH͉M%)s9s6UH9\'aeѝyj:0xz/WIGԳ VA%Pg)j"XdAX ,+$EBO9lF@Ve9y J2>e'1)LkFbP(P f̚C 2[!N M@3W(GS W@U|B+:>{b?7NZс QTq;Q$Yĺ>nZdzubE5ЮoƜ[e;Er) \YykfqQHoD/cr\Fs0b<}C]i4&/i_Uu}Ϲ~vgI&e@ "(`$. U\Xh*W*֥P@H"sK^ T*TLsνw2f?3P_OEcqAxC Rg BVB~V*XN ?/_'ĆaFN9z%wfͰU$|73籠Gx.nyMKWqly|w{z0y`gw_oA8#ςK#wl/}zz鰹Hu/-i&``KLj&E+\)JAD"D**,rDpՐxaH,Tt+W"T0I=jt8BV؂,! 05th $O"i ԦQƷ#e@0`}XMIY"z|u^+xFSu?S_zeׯJiZ7vOφ8%b{ S~96.KyYj ߃mO- 8` kҞӮy・J_3x<о cj[x*℀qQZ#*AP*c$s8K1yd$leePv@v@`kAN:UM;zSAG*tA jڥ.UV].g*67\(LmZBW4-dېkd 9sO<4 yX~~% ,I}]^pʥKYV4"/=byC0A\;xRbGu> a ђdWY$^ZCmF*OuPP(L)xo,g>woG e=yM=S+vv/k(@8OLӋ:xى? 3 K FF',cL\a,.V8bF,cn \!l;_ɓt\LzAқvxd(R-d\~~Q&3>wCe9vs s"[*:Ct)d \ƎA GuN[Xk}`_ ~X"ϐ=c@OɏnV׎m;ve:O#GrdQ^)HbdtaO JȻC/p @IJfN,򂁆 ߍ&a2)c~svR8{=x|HS$DWSP|0"0+U h)i4gjzR\Ad 9u6ΠOBz&ҿ96(V@BA%)IM3>u=&4H}&~0z"Jn։ł+W@ކ>dZ؏N:&II6"RTR_j&.E`;(O8+)bm%n9o! s5pdx)81glP*Jj&o:UtrڈӚrHtթv.."4): ţM>?@zp8B{@gv{4v;N9}T#c`D!$RI[n]pc H19a#D/ 5$@PFfđAW{} (c]-Ԭ-͇2HrTYYa6i*z͗e5˾l-f[ ~~&y\0"u$$с"mGa qf!?5pGԜoɦdj7$Wx͇^`1!ҏɯ6zZMdGG6i%50W#9҃'!O=uJ"fu3|H0aA9<Ӟ`Њd,̇s,޹Bxviڌˢ`kk$V<&n72Le!9E(wCs"nXfoݑIHL]:8;f;gPMfs`K`ꓛK}ϼRڶ{ rŧw&=X~lym韥W@ vē@R8ζhx co1J9x9lCp`fh{,VH&A0x0ou0@ÖꮸꮸZ6R4tl.Ti e-qÍg26j @i@Yj !ڗTʃr0پο^,z)+n}KW_19C Mvள3f`rIࠍ/ؑlf"9=%8-SdgU\^E_JEG?B=IAK Q6K5Yiݝy#2-\f5-:%1zF ύ΍.b/\-z[ֻl?E"9 yg5Xҁ:XR7BbNC!0 W0M"x-^Wh ҋ F0li )R.ʂ !UIU됸;+$oDӂ9lhXt2E~xd@ :U&2e cs KHr1 xH{&] ު~m1e?? 52r zFgzn ,Oztǣ{tE4#0H;XKp(;2 R*sDMEH<ϹL$"?d_tONWY 2YiTc8B{,'c4 |o$H5M\ ! y=<lBnbj rd9FU=Ggd¡༼8PEW;l0VAmId!x?\f2xp笋gLwKm3_ݱ+J`ut+Nw+5DjVtmhEw B>Lhs5fJȀT|mjsdo)\u!ᬘLd9E ;f0.c?yΉa W!Ԁ/]=zh8Ym t`W`i'@WPIԍGHI;֞+;RY{JAT֞Rя=!iGۍd(;oMb?[̉m;k$@ ky#txΓpwJG 3nzfw N&̎p[Y] Q9°|2M s+4_UP+ˁ8YY . T}AکY.!h~S nvݼij(VX^6{LQ\ğndAUGH(KII\P(rRP e: "Pdwnk#Ň%QL OX d}"U&%J`HҮ.!aWa.w6!'vpŮfwX7]kPb7af [|&DڡBP8p#&DmdƆ:걧%_x!ܨvl,>7}hNxO%F[n;f/gIJlڽ׺[h:,Up>8P~=.CU WCT0Ю6]>ת-\+SPרNC TSof5骱4$4$k53ǜmc4Alp(oa[33yEKK:y:$kfς(OB#+>i?g!$>+sXhN"ZuΕ bN9e20|ܠe̱axp&Ss3 fHH[``pyws3t/l5c^dv3hxGYG_b‘YY>Ò<?k28 H@H_[YD)Ac^]SU`zemPi+ɀ3W$%"-PU SЫB ~GT D8v֤Z!R?rI9ot^Tߙš${A,EkohqDdvyXZ]'[vu`72Az@xAD JyLtO3'+񀊥Ze SS7y Kivo:&3WpsԊp\IHgT j_jxt㊶_Cy䘎x _ ":捂 '@pMpemYei& 2D'yh}v“tu^l-^3e㼆&4>8fq~+?L:HQc.rs NE9Z\Ӝd$͉4U: 2@.a(/Jdiʋxz^ -yU$E>NcKϯAL$q>r$h#08Ǿ~*O/ԊhFYY_,L @HD+:QETm~vg_") A$o V2l6.i!%L+6ĵ8qAc gG[4?X?;S#vMpmUp`jXZur28I8Y%A[9)9 $!thm cI(1$eb: |\$`YHur^tf0yU#l,&JȠP(! J (; دEGAn*`w8Z.nq4ñuivGUR*IYh;("c_9~qjca)=dG_nKa}Qkn5AmFk]ZgBgԃyWr=ZAU"iQ:lGH |(O? 5Vjr99$cXWX{IC#RJ$?)i\@qgmN1t?jxW23*>pG2mb2s ^2*#@.%XcU5]G漧И~{ ύ ӨW4 Y$A&\p$Oi$'A ˹JpC;nHn3oݿw?3떗_z.ޏFc[M)ӢK.aޢ(\vt R3*Vl-PV)Vu~~N|fBok5:i]Eo  Hl&}SH ˨M ײv-3;(D LX+LXkZemީ? |y I<ʼ;lWGGZvC6V4m,s/F7}wA\mBi$Ã<[HCE8!&^/wU[IVL7nӛֽXzO UoetA1W==]U,*6zL _b`pX<m=$y£aս׳}wX/5hBwe}3ͻYi\9ob~g0i>ND|m‘8Ä#C 7\[.^qR#1b5 \ AFI2HlH$5f \_9,i]Wb?w ԊV=p둇ͧM}?ºyq~qq#?Yz{@4{c*%̷þCaf9!4::lOf=\>'z9w ~Cr] Rǵ߳Kꡏ63[w_ ^{O=ٰ{en-A#Qp?V=IZۖH \K4iFP 6vBK/b^︂] 0heϽkϹtIzA G"ȋT(KJ΋+7rϩ]E'(zq /ݠ22kNB3ثpp!-ۚj/ S )5k`@I"N Z1$Cy/8T`EETlNޱq N|-Gu]4O s78{h9'( g)Y|eKE:Ү+oQ)vj>3ίZ_N[:n2tR͜95 ku}Xuo_UY(GaZ:fvN7eh[K yRYZl#3b=Ux|o 1' cUDQ-Z(B1&}sW bno &<Qǽ}̂!K|,2^R6͘m<_nPb$ e1M5f2D9$KWbUPT#ȳ=$n F7i %W\-8xHʎ땺f=QX`LgVgDo AE[sVzw\uoO^M'o]/nK Wk}غQ{%|gڷ^z7ȓu0hݾ(#1v}Lbvk,}+K4DKlHs{F p6NUƱM`3QYTG0D(Ν$I4rK'}иD,H0c;i/tZXk۴-z$E7EEl>>>YćwU`i 9>Ĩ4c@Sq1/D)3A+Fw厎*u I1ׅΫ)X^rd׎O 'Lt0]h.@jֻO>!`"p,K45Kcu!6IۤitDT"-[aI.'xjۙ 9y!v#X~="fؽ˺qtg5+C`d}U\,JȄ V#l UXL~Ibe'tܐ;Wa⭷ND4yhO%׺ 5_`z"cdZ~e|B 3/,&Z',b0[e-Nפ^Җ@ZV+DiSf( t5z=iXHAOƯTrF6QaSN#$:$).v (FXLEӨM9%]H?p:]H/UλVН@JھƖ4kA psB|&LSGzCU$x?8-!8܉Ycfi f4zCc^x|[qR6C/J7qI;?Zdc&xI/$Q̺ fvx, c9R(@fHK"e"y6ǎTgcE ,>yGy&m`t(J &Ɓ Wtʢ gRLhRuΗ`;Bc,O̩b+C6M%ҝ iAspdEZI{Oiv'CzChjၞRڨ%OE?W*}ڮ=$ EvBюv+} =q/a\7P(L 6 XTwU[vwK@φ>zvn7/mCD%7qw`LH֜=oѕ'ߢOto=Ej#\1gw瀓6p;?n s,^1DKmp!9 ? SQbrD+dOHeFIy%).}ĵrJ쏕3Ki3sDatQ`:(PЩ jV z6t8ங:Ac=yq%Gj; )dJ}ePL̔KTFb4!d”f,b%g[biܒY4cJ6禃XF/h1 1~N'/9dzS0E)E"@S);OJJ)5;)s', I+@4Ct)B y1M]uWnWd፽'nSGܒu^]]6:*0tWڪ!-;~_lI,*!D!S$/dO': ʿ#q#FCB)A'zg\þK<x[wVv^>'A=78G ~{: ?Q0ao~5|9YbaɄ{q6#ں aQMtU;_ϻv"N=8^*oU~BRFIMj0RKr^zPX2=Nk#q,)->g jD}ދ(,˃\VU>u+'t+<=Fa?3{#ѓ(jA?-IeAfx4v)G(f. QXI|m~߂gr_5SWuҲ n\^wY|+Ç*-Ha/;#q)d‡s!ANSb;?W.X1Iд|nt^VҼ6tm 0"v)3#_v2WqWɝK%="f2@v>f)gKQv(R~J;*ĀWdF !_NB= $ig{dz=TDw)B0Y\LEcP<.],/UT8=I ']lv/hln;K<*+Rؘ;T!4h>Z= Fo?׳nmO]zPV=j/{,ڛooOibsUZgL--J25jyQCeq|l|yuym@{_|_L͙v9=Ϝg~|Q4d*DӤLu 0T"PD^#/e6C*x Mropۇs/;k}Ïn:`1LZ\c4NPm|nRH[bZb}b)ܔj+Z^ZP].^S3Y\QEyh1@SgOS L+iJLo#(d(I@4cm4_LŠ#7hߠR4%Wpxwsg|9yk*N1TT T@BulaQa}/){kJ2=5#u\WK߹ծ̓?qœ[W]eh1'Li'8~={~w-kÂt 3> MM9lv%KDI [*TY^/B,aTvjwރc 6)|[qt9%kOc9H"F%%~fl ڑn*N:g.n3>{ev1[xOUMi[|]mÇx Gϧ7BĹ)WnH tE.e4@gFv./'Mh/ltgœg^f4)FO{?ƥE PK|uD\"-(K%Z_e_A+jV̓*WV^Y|eEw䟨{x3ꖪ'{+_V\ODOTa8oBDO~Pq<*l2SaQEIz,K2D[bF[ H$&'ؒă xQs8`plIpL"MHE{hl _Yu jiS?&ȦG)%IH8xSxMNG"&t|"C>ȐO%h.A _ϒ\͉.-bSoGeo-%&_SuBօ(EmMc)mZ0ЀP)רq;Oƽ X+!!vx1ڞ04O'.$(tG({uX!`;#wxtT7"0)ˑ]NDayC\[ߩ:*-3dM/2) U )ȝmT/OrMkd>Ǧ@YD>Pg6f$Qx)H,'$H"b`2UUИͧ az{nY}^{lYj}mūD;_z}k<#}&Q6fKrSon6rEYxϱ;1xPeFDMZ| p%8N@UM Rΐ(Yʠ-X7 $ia-X݇M6a@+CG;J`*O7R^q1!&I x c/:) ^ QևI QVc#Z{L"$1 AopN-K%elhl-#V3L;쑙<;uwٻcG8W]F̫6AspA];9VfГp*kBp@ q!)b8pTj#рM Dx4QXZbTG]xy iHA#K>18 $ԐD<pY-2ښ"EC&< z3e㕊K@5~~TmQ_}V= dրjRnc`\i\ txtCk{{G䟃`]=xU' >Or>9r5 fG8'm07y'<%nP @Y FCxU軈T{r{r>, d[d u9Y իP-Ǒ%$)G )7a``G2~`70YZF⽒v@d  Z1h_y_u`$;t*t7Jy seYy$ќ_ t4/荌3L\js7FU)PޥUba qwlf[3"/ [-,Q* lq([߹*g{~(S>uT9dsyOըa{;Ф;PC_![5R-Xd/a c|Q{9N})jذy֥cy޲? (6LiygWIE˫ROIW$EC&3SJ^Bӛa8ALqr1:/tqaJ񻡛sncg ZAVWUz{h eQO'`'[>t=d5t?. Gw[]Fy=u KĬ`duFjV~i&jLҡƧ4hyY*5PouZ{-ْY,+p/(.tysMg? E8IEEUeӲ1!, =K3 88A9鶦e9Y 'B K5zx!lFD *L )G̐RvW.r\jnxf{j<>: vtıS!vO*Z@ttm+o2j0|;62!;ivC޻] mk  c 0ޝ;Ěfo0Cx,qk@a3+ _P QLB&w(v(SiC~m|湍cعugjŏZ}cZtCz7oŚD9מ ` #JĀ "Go:F} tl[jFY032?? aHmI2a)%1p>ٹ\ S^4?dޓd~"B e5 A1cTûM:n5]XGq:^q@;Z=VE-NC)jQb- %{J[L zie-ϟKs|Z#JG1F fR1TA9_Je{8}SFxbHa>XuO Sj UՓغH Fa #+| Q3{'s}d$O4IUlHCtKnlGs0eG7APPT*JYJu:<5:747<7888rJɺپ9rvu_= ns?Ak{8] u=A +kL44#? 7(cL5jbmgC_*VYEE'_fէ_Jt?jaq~4QBN]z)B,R2]3'VgLuBۜ[oBm}jJѰ脸y`cVW1Ǯ_zﶞ=w6Kd~%:K=ԏ~/lpZHgJʗ0Qzhx4Ü9KGEX kĜ"G(ˌ4!$]jh$#QaA2x]Wh5rч] Hbf˴M:/л#:G*ȟ@ ­K0`E \YJ'E !hא9HB'mоB3W,^H3ŎX)Xz"YK]dRR,b7|cPЮT$FSg'B#r7-XR+cCzWn$A\0XFOdhsௗ޴~ 7 ^vaS{Uip?)GGJRL!X*5$R1-u3Ogwn4@{6kP1^̒?&q-R#_!n@642d[ܼe-.|^|Ř34{3*zc  ϤթRvp;,K!g"HA:~e ~ C3x`ꠕ  Gnd>??C.7N?!h0t D]_!(Ay~ U[[aRmFac=(<F :NHUaQkjZ5g:ƒ#8UV^8d~=ƉVyAwCgNYwB(:zؤHt=$@ú vy?$HQ#@~Oz: 2RNcCӹӵk9񈍠mt@8F{a4 6a[m6aC}O^-UU6-Pφ^T/'!^bZ!ԍVh;2dAbZ^*@ $XG.A$8x+KvX@ xj}Kr֍`p¬)g(:t5kY𱀶 Eq'īDD(5򖤘. THD y ?uD v o;Z˔;<&dcC0VGoT`9.tS-t+1 F?=«_%+~kyBgz#H3I[h=6f~>ͅ>RgETOna8u7ۧtp =4ٍ4zUԯv|L` wo^*22?hԓ'8(~ف[A7V$ @@?,Cl?4]0?Q1Z jVo2-d;)q$TӨoLb a \ N[tw}vV{9~n||i_a8>N&|ð28#hD(]ҰdUPߍpl %U QE<ځ9t\ }GJ3Vw\-CӒrKl9@diqYiRºTa.&.״L*;ygE)zp#O8mr=31.^uќiVQqh->J*pyaD9X5o>My ^g(Quyri%a5*r?H$` Hp]tuAR+jѠ!WnbW}WQ2F<@G7zf3>Z Q(`grOXbtִ bz;3wnFkxzsZ\n|lɜkf6WMw)An iHdBEW/-ud;M—[m K]Q 3vɅψgDg3&jx(lUot74M7B ݬ.**.QD5p!DT%ͨq&fn1I dMIf$fdyyW Y>.~sm=i#MJȈc 0)&夊,$I[׾qҥw*yവ-jyE'rq3yfr<^osnߺ9E6wS4P\Lmlj2\f _>_>yAhiwNσp]!qN('  $Mwk}{'[^AAlh |<K6>D"&NXŶNq#,ȏ Oŝv~ˑpa+I wdaA^A.0$C1HGWk_rTuD NVCЅ 6&͠g^Al֬nfH q3J' *<bև ӣsTde,HQLtR[W1_?問ΓNrIZe]pcr8/3#`wrMF]xL+n њ qo4'ק[6­nVfM6q.V sʤhlP EɄNYd {L9XḀbgOulˢ¦(P& CDBxbI +*wX M,էܽqV껒 fw'bCXw 񠯭YRNRRYlyáF2zbOT<<#Qlk`9a;QI`dNh/rnё R#k.Yto'DÙ~=Y؝TU ޝu`ֻ_m6[phO{fYYGX Ɇ6edMY Q ~œ Ad"$̏XP ZP8QW&*҂>_ޛۻnq-#U÷ܶԔtU]Ʋspp'>YYĄM`&#lPCZ i+a+XntfR$7aA/`kԓFQDKŜBKw>sFy;1;g~an8uW}w/ƻhX,*oMHA_/D,nAdt3#ݧ?(᪋ObW&3=H/P =d^ CZة9TӻIa_J}Tp*x`4m ktN dZyI0zme/=MԢRTu3C|Gyv,˸‚\ʼPM ZdnWd4;ϜVTsy=gֵ,.hj3E}ő겲wv^S5yKwTw6fgFML6N@Dӿ/}E0|X7{mUӠ#76zFh12#TaHCjh㠅lCJn+tln&ݷ`-o幐"3NWNt}r Ȟ59ڤa~WJY4}36<ǩa7vzidy絏%$}Hly7:*5 1h˳`} Pk,=i\UPUqY~uIs9N^@T' j&:6n?&X1"1!kur-FHBMu6ypΓ/(_\|k͑f^1#?"˜vx;YwKÿƕm}y`ƦnlZhO j/,u=uz~~kY#nWJ7啮޹:,.M꣝`lPeaခ;~5tȡS8(p p*'8iO\zu2Rأt %U q4D1DgZt g%ĹFX9, -t~}'לYϗezcK-쨁v+x^|vv&[=X_"Yq{ t\8u* upZJԈ1,\nC l&z*fƽ  ϏT3c^ע՝z4tdP8>Ӹ P9+JғZH6`9[ӓU]si! ھcEѫ/ι ևv̞P-0g5*:\##%?C'_ jfCAI|$;fWMe`"rCV!V#V["X|q5)vCb)\ǚְlr%;#7za)?.V^\\ULiINu]P6 (9>ov^͐˩-Ǒ3INFs'1F8LE FN}DnzlWuY#J;mZu١܅]m /^4v =#a?_ ZF(rIz̘^$]9*R ANJuJCc)τM&VI2D*Ȧ ww?ezvGm/;qdi&gy #[9Qw]{V}omiV~2jhLG :-w/+ `zTUE;R*srH v{-vaN"Kp0#f+kdJ5EnY\}[i.5lY{z}?-s>kUMYǂi;fݼ0hdX7FrHKӷ}ֵ߾n[m/k͕ջW0)`ʅ,jK) њ(PmV4A55tb>KR /O_\w EvAr%NDuDYyw..OɦE)Y3h/r鮙sܮX] :懂5es]ujۚys|uClͿ}g<,!](w l01Fb6/~ iMJM|w|Y"@dHLm&J(GdfS!JPBiGF9bR*ML2LG$|2NGI4a@{)`r̨I&5e5B)v` pnQ8~݂~fZKTv3T 6 慡TG(/f&de,ioЕ$Ҵ`ZPgKEU9sМLwH}~63RN$f[X_S3E*,.VN6 n2ɖ^~usųVrƶ?.Dͷ޲+/X5/"z flZ|еچ-Þ9ZoY^^S~bZ8gR%;cUuPv@VȠV8Xk)/{]^;J@hVDe›5b2${&ߝxCW-;~徭4 3ہ₮[hХ5׹?'=D2jRH,QCRzKGu:G.ʐ\i ܏.a]|]=',& n K!6zաH=-_? mYI=ŇLs4 )L$;O$'z/ ~rq}> -gɶhI57o ^(5l.m (//fTJ4r'(2@"{,u+)I0.ѧכ^9B%!Dp "[$I4o =8 b:hՓ-ˣN{Xt TJL>%\)9C.tTIH\*@ϳN|Pz\b:V=Fo K1Ԏc>L HBsh?v\G'-I3{!qwO'"iOLjn[ב:@l 3 5f0>3TݫU^ *hqQ#9$^ jAQ^2**TK@~ѱDwoV|'Cqvc-A El$|V*Pl~.t ֊<:$su%/.B\X1jS؊s^8D˦á̴} gk1m!L @1k&JIyD% DOfl:Z鑜zPm(zSzT [6$ Z;S=Xmp T:PFsO=-Je=Qz +(SRSwrE 4՗;c+* \},!IL0Y&EXtn\ٙS32 zd,glc+/$ax\F吢i *B봒O?|[bP/5GR&| ҡ}~Ìzz%6bcTEP"{cK,f9Q&6&)&R\1rdV(LVf xTHf<$VJa6E(.W6ZEZJ4|(>e؆}Ӊ/&` 哏sJulM٩g 3. FM94?Z_-sJ}^Ƀ"ODžd;?㴢Ķ`82%q3sXP֨,*oB4!(bY*=wv$7#HB!_MvC6q!|ZZGZ"Rmb,E}gΝw|I;̜33g93s{I'4!sIah`)p8*jdnRR~exZ<2K/~4i Dnl7N̟2>UWaq- 9Ϸu׷o}'ٶEǍi=)o+IPx%[oR1?B(xX/mVS'OʵuWXԩ l_8CGJy-7c`'w `M_cdnQ[{ b阷jΐ5`yXu ּjΔ0/a R@~4_|Nt"G_VI}-Fd̽rM [(+r{rٍ4bn(gIIhbÃ5[wD-׍þ (`o3!w<7&0w;.~ |ͽOD+s-9[ߊY۸{8 'NTk'%}=0a=w}2xCVfĤ!ڑF-3c솴:'|0Ɏ)S7\tG6eNԲ>.73?{~9%&Y;wesjq/VBkה%ϕ>껻z(zmfhoba?@*X0=9 &o/N*ZsA*(2ʪ^)u ֬G.dSI}D(Di^An4ehM0 ˻hFC>0 l@yH"M 8K9$ XփX%4xEz\C` f=M Ir\Cy6RpFJ8wRG[MiUSys$TN鹇#UvK)ת$: KIJu` i<(MSGT!&oZ3H|"͉ijF1R锛p:nFa&YܺNC[y |H y3d?ޛuq cSm&_"Ű7;R]&5+B}T:mPDZc6vxInN% nhKpGE:s**QMQ\6Ku͌`-\Fe3xI>VrҬ1sh0Ƌ6 E}c5YZhammCҼy2Ik[A>ZfHeԇ ֥)ZFFcuF=2؉<rUz|O@R\Y'ECvW9pPJFבGU-dfAcs |3!:ʸMvOY_3JGnia}xm5ݞ۠+ jMp%20콗z vKzl-TW-NR52Ԗs8^x=i;@fYj9WCWx}+Yh$>ֶqՀ=3 >|Y%B)n4c4Yq;%yU&c% (ԦkՓR;kofF}דzu]7tEo[>Rn1!6WK`߷0L Dȿfj>CX8 E/$* a[n.,>rR*iaj!ƹ1SzEXK?-5Q TPea"7.8<t JGel0Zq +i:E4<ǒKXr?"}pTă|&ȿ 9[F+D1̡rh J4U΃lBZ3n>Kl\1al&禉8{OKiĥ #թ7S8?>RBGVr1M¹Mv=Up}+Tou136ݧy9i+zMF Th^Y%b\,S:ujVLS:rj8: sc{Zպ~lr5q3>=x u4TT.+X71:5B(kN]*w A^r.8p*j994;m]L^Z>>6z^=*1°_pa25Nw>բ8lSt!v{IJ{=٘Q5~]NOzkpӽe96K^%4N/E='7YS#i+D!/yY\tͺYifY.SOҏF829HS}(=U5v231 gJHg!g-'^_EV5uw3xѪœM9qKƩ7.SoޖO7)aZuy$5kHahY;Mf#=laWPVFՒl[YlZRn+).s٢<;/,{454?.GmD⒅9ej~qaN.&Eʲg]ffKSseɥZ؊ R 0fMQU榩ٶRΐ<[16ى5WYfp47HKNnv!U+N}H⡳H%dOU [=Ϗhf$,#b4 SoG֑3߈م_6.Nf m&`)o%f׳[$'Xna mEؽ>F_ZR@%9.\uYG37k9fbk=HVՏpu5kk^kwX;z›c&39f Xbd <-bbs@͍~c c!\[pYl9^ᅱ^G!ᕱu7#|KRO~ qO"3>Xkx]u[c+8Ÿ^z-^z;AK0 3Lx ~3 {~6~1^J8 aO>p>G|— _!5N%QJR~>xXgr2Hr|.XAr+J~gg){tnp`I#F%¤riҥLNb>'})Ǔ- %[`IIS&ŔkqJƹKޜR֥ܙ)wlF d0$A}ż#mxE8x{|u_>/0)~7ߊ"|;9b8;cNK0!Gop_>sg ?C\g1pԲ b>{%U}nX\k>= k^ 0(Gn-=H,Ϳ¿Mp5r")6Ȥ*V&Kڜ=igҾג'@;?ydEy+%oNޞ3y_kɇOeD 8__8ڍwl?psGWD|8$3Bpgx,63Hrg$zOx׌OJ6S-f|3~ Ћ ^^qeB/K~=>z 3^wz+ȧA1cP+2%"^)Emj!u DD?xUĪD rU_/"_m޻">ǫXgu3M"~@Ŀq3[}T(AmH"!W#>kcE,E*vWx "@fIkf5憯 7"nnƧ 3D\&E|JDK=CExdu O$vxvӰ^m8 ļ+ubo'bAͷX-sE|"Vޭ_z1XE B?6\)b_Qx[D׾|np gxހ}p$\7fIs%hQPѧǛlmz^om>HĂۅ" 9z|r8UĂcwXp.͢fH%YBCqw׉XH=By[ Y4K5'dG:v ?{U><(σE,FC3E,{h{S}zH2 {)C/%xw2D\7vA/ĸ~[rzIgT?&tqe?C/k&wV {ExQ8HV)Q' R4i%HY7x=l}#ٍ{qwK(wAq;,  忼VH_ k+b#~R˝#ׯ]zJ.a)w[B2WD K[&XX yFap"b!Iϊq<$ϋAB?byIK񟄝?/?ǯ&=/zKzh/}DS_[U^iۿśKp_>d[۞wĜ;7и¾S{BkAPpHxP:$jՙphCDj=1%ba[ͳp8 a0000|{HhxD#   _ _ _  Gca0+3>ax0<9 Ga0|T>& O a0|J~Q>- gyaxY_޷gY-f5fcיOgaVs=f f7ךoG;ߙ3lY =)/u$Vn#&o=mE]uڴhm]kW;"Y{*CG=ގv<ӜvXuV!F-S:ʶ鎮'1ugǨm`Mڙ?JB;!k>Qok/]ᴃccvwV !0$ [W:cm^owCB Ja|k_o]sֺܖX+&rC+w.mO5dXm>˚^Y= .i*02z;vuzpu- tP-ziQkcOŻ֜"'r/Z\q4mtunǻ&G]\W츳1Ӯk/eM6-f{|0Bi \?FhQQBОBaήX{6HEݳaxPjaZz|Ľ`ZxQו.x%:Zu_W*N'7#v3;?+wFy!'m-+%kij.s[ipRGytf8NOBB{QO"Bfu_uk{6}}ߏ~(d"~5:[jrZDjkPϯ:SFAvT<}=L~흮[Vv PAvyZ 3˩0ۈ7[vYoϓM#+8b{ООHy&oKDyzvKtЎ>zmgđƈye}lA,XBvum;pWɺiGzN:/k2J Σ;;}Hw[i\NϵvԵE8v;?BZl+hwb:s\383r{!گvѮ:ޑkmiGԽ6$dmҶuHgtuL9ٸ 'Z!}5:f+ECyQ{jۉI )9>օyǎ[%: s{۴۴73sz{% iO>n7ri?Жݸߍ~;gIE#kL T7ԭzȽ(miȗA^NQ`_/:ΔsU=dX] Etg٥r~kn[H+hӫͿ3Ύwz-\+ ݣmezܙ]L%HEHDu/M94 ߨa|qM!|[U tLVwQ>qn[ w'g;k;^Z6Pj!!'QZⵠ!=\nΐ::4;e]RvkB8L @It viKLĶr۠'M4'?4jC fźTrކ|W 6m5dm9vw!oskp3;=Xtd۝ Kg$0߱G-M碻J[d _ߣҵdA{i?#Z1(^XS'S6sz9~^C UJؕ!3~E d]/&f:r3yZctΜ1v3~%8B:t"OG<4q8|.yw5ޟjg4I"5+k+g UXwۮ3罋i?1`?} ޒOyQu!~jkCpe%vdVjLqz޵3KɗD Fx S!C&,rX` TB/W$].%&Y%YJRsapi&Kf)i_zMzKzG: !}"}&>f$X(?ɟIYS@X8JW T)!PEU+#ʅ(e2VIS)xe2YLU.R2Jr\P.Uf*9J2WL)T)EJbSJrB,T)5KYPJQJrSҠTUjeVί!#$(+!e<ĢL8P~CoLH@9ʂDl2PA2|}HRP~}Q֞>w?enGۋ}SP]Q`Eyd2iPdaQFυPN.`0p Jcam EP~ǃ2< OFx|Jz [#(/(?kX--LyGz I0? e3:p.D=F.| a Xi10#QGaڣh~ ס]z `^yhAm!,|V& \)>JN()p#ګpڬ~2P)A_aڰ!p3ڱp 2nE{6MG*#ʅOGWui' {9Ϥ1EH#ED)R"HSD)"E)EDib" FD&YY| E0 b&EdĈ1`{@3߬cY{}gw?>hE%B]ƻк">Q/^[TC#^!5PPɢJ>5(T2B!Q1W?d|!! u(l uE OOo@c?+>M b_h*%=uAL(:'DGHfqamemꬭpxE %E)x # AG9̊aEpwq$p$A)qducuguU.VձcYOf=WCHU ({C [ .дV*YPnXdz25qkݬaL+Wz}>JKZP@[P@G:P @H%ʐ AH+eDFts8.!;Rz#e>T.y4t[ #%%@ dEZ" e!TuO,'Òb>8񣬌sY a5:(`)+cY? qhߣ8R'XqָŬqOƕ=5qKY>)ʥPOOBH}\~J~ FB>#hߧYV}ok߳}YҭkI Y>|EV u밤Y%g*-[bޤ7N,̊~@?a, ?;9{^?\{[XC7mdC=sWXIJ5+[Y=깍EVJVϗX=bm ]# 2kKƽƽ𓒾Z g1$ 5&nC1'AOV4S!=` *k.!%n4f·Yप%PVdU:j=vc1:(u;knc>u;u8vX%:u /?2zhGl'W]!rY"a=I)Wpc"-y]{s/#xqLL2q||P|i %sN~w=BHos-s jZf6Fgi{2,Ks!$eoЅZaE[ gQmVJsά'ܪ߈ϔqo3O0zmz 888p;VNr7Aݞ`^1Q?Ay+^M?AЏz=2!M0z 7n:j:kc=#`dl!xۚ紭 H8f2Nq']b} c83#{D~{>3_v{E;V%OX+=5z c7[Jk-˞~Nn{{QnA!Ϡ}Sm%' T|i­~a?@U0]Mc#==Ot OFu'=<8Zk+<:{4 '93 әM-=>zgc+xp<: vb`.s+̀șI)眙SNgSA}rȽQg=㦳`Hg+νS2vyncd:ni՗3ڝV6Fg^З0N]B. 3^ًh^ʹۅoa#P~M;"yWa_Sϒo]q5~F{3/݃TS&ԧa)l"cdzEak!ZY7_ w#שcU8/p#'5erA~{R;})Rq{cr"# _1QϐʃA&x|'l*/zPs.?WߢCޅ9{ݰUv }z Q-:J, CVVM- ڰ ]T꾛ZVSG~o2 \}Ȉ{^s=o^~-~Mc;5=B#.!KWePԩ{TzV|~\ŷd?Ɫ/"*?w,P|2/R竄hOrvr;9ϫaqMeQn5C<ur"/`OËu\iR_gUSoO3N*ߍQʄ,d6W$. 9Z|m>Q GŃ̋sGB[;A4G]7VS紇|GnIZ_W|ʳO6ź|_g^zߚf%j^s;?ϳa,}BK[ym~#:#OmfEڟ)(Y<״r̩WxErXqm?m61?Ghrxה=mOf2xT{VxN?}8k#˞|j구lo㾽0QҺS~ 04<=G{iqX>Y5Yث?}v/oClQ@tua-|# p{NttlW~o$?!J/% zsy,G5TIs}hy(~(rϳ1ֺY)̿>F_D< ?=c|QwKg.E458~3c~'߱uf+ UqgIoq5~\gI^Gxs_H欗5Kyg8 <#0=̞򈕰M pT\=sfQVY-D ?0?]牫.73GR&+uYQ/^?8 ҄!ԼQ%^c0nXS8ho&s^෋sN!Bmr^1/)(9b6@GZ'q>Л9M!R˜2Lɀ8XUy RXMle(*BԿtk]@fOP24oGў;=BvE;vQRI'~_~Mtxꉕ?+ Px0h Sb}4s8{]]/*]s]su]6QZѦjhӴGZ3l [5'̟>竸s:!W97]7Ӿ"rrOzaqLDͰ17UnCaj̎k7{\-8g΄8V Puq]` s Q3 խ:o BT(:cWʃ/`CQg ]?w}ľDxo*b>U|P%~v$Ӈ5ñ6U(꽵U6ߋJ_e__oGyGz-~33{Ց~~AfO{_Q|#}WݱOؕ9gF}>3c=} s{{W)FYٟqJң\T(}J2(Ԥ Ʉ2KPN1Yϐ%r3[̷":QnȓuMȽ,qt㐼yG6G_39wg/r;eLz;/ܙ mְfKӣ!eZJouY_᫽ͣ'*i8+`wƴ~)9_D'bΕml pW:i:Yfg2QbUZ$~Iow߿z#Ԑ,(Ǽ-?Q*`ɏJY|WR廦 A=?Tjr;?s|yeNB;Fץ]M_j`P4_J m:(N {b5W`sX'Iu^%K^Yb~&]fd/Ee"O٫Ļ~ILή->b^ܫb')ݧ'XL$vK bx|v17q<;a.>!.WĀ_RR(T*UR.~\PWb4߁ԓϔŧ]=}rV+wkGPji)ǵgiY9YAegV<+4ee=4#krK{EVyV{dM]Q=*d^= R BB[<vTv(SNcLyB3u%hk.0Xga/VQؘ 5e}gZnտݧCa8mP+I'3o_^oQxG;trkUa6Y[*e5XM>jxNY] euݺa V1׺aeoOJa7V{jAv.+ը=6k]mF_o7a6}Ov+v# XqBN:N3z3w5;Eg9Zq9-N%sQƩsv;{p^5Ns9uN8'3BسB7sڝk΀uιvs͟m(w#S{':)ivu??vuտn/w_ 5alpo_duAֿ˿`7[v1Mt5o50^ @,  `f ʨͷe9l l}֪f@u`6Phtv^h\`?ś+pйh7{h5 <8m ݁""j \q}`PǮZC55p.ki b%8#Xb-l\\,.Օ5UDp]p#tkuvUN ꝱe!sw o cN/_<< pzg烗VmZp x3$C٘rBj3 !ܱBE1؟3[U־мЂP=!x6(TvW{ׇ6[CUP2=P-. xXɿ*/HKhj =BBXM} CWCC7!j&#<&Pg@8LJ'Zópix!,8kS˜ Z4Qڇ Bh.ëZ)<+!9-RpR<;p}zQ-ܘ-L wGǭsNԩc_ _q1g~L]u§D4xF%Έe" {Gdl@,)LL#ő7RlGFcFEDGVF8c#F?%RIΈw=H -Cz{=vgxm5r4r"rҟ wڥÙS5rQy<<( ɑx/5**E&9rӾ@}ԱQ#ESqhQ bN(5Dgl;]l>Jj]lG<45WE+룛PӈnVEk TѦjs6m ףֱhGT E˾Eތ^ވ^ W6 dvDHqtYY9h; քKvs̋HG7D8^,Ϗ/rP|y|e|M|]lm|cls|K2#^CNsqxۧGpmn@tZ,6¥ KЦ@g5$$roC"Zew% C#v7Z4zՁH%K? fs(111žh31 ֦̈́x rb>1YX(OL]W%*`&6%bavJUdhW!dϢX&OMl>њOKt$N%ئZ/R4iN ZO\N\c͉-jH ED&UgIrLK6N@2.H<\$Ɂ$+955MNJ:a`$d,W'*žd71;ZF+G6n'W'W$'bf8x,Q\φ6d5"*9Ӊz Tk1ȒdՔܟ/ jw"|,"- bT%xM*Of S{%ZRRSG 'ΤΦΧ.{S> {:ȹu1/!OH]*qfDύagS<|%s ϱڣy%^Exu&(4^9( =^__ZDp`~To ŏOT&!;.6}P*p/#W/?#dIп]ꏁ?gYgѼ 4$<'0Ji~9`ܧo{Ab3z:.) ❄g; kVuOxThfe\q!<YpB=8L{2!S KY f3 7d!uvHƘOǐ)$K 4pv (!%J$2-pfG[L[uH} 9~@\nV\ ~ /A}kgP;/FjUޗ^|qc:2yB e<\FQzЇ ?p/p`mrdnf,O~RѰJ;ls2B mÆ&H~T yO;ET1"wC^(f*O!Ӊibsj=R GK6v w@,8]`fp J;.Dbϒ9L+PzT^h*cjuYԷ l|5X7Kӆ O#=lЛTm7ZjNO1Gf9t I <aC'p1&JڱuD/U% s~{{%^PQݪjT2?8zU(r5Bru : 6ߨ@h/)AW#WOWQ=S [Q6 :9,A޷+Xq7a>:j&}jMDTc6 N 44 w$<4GǸхZA<]NCnHPP觛G;`Cە90&Cǐ.yK tAYUWS1~5e9nEA>(88g(b ̧WȆrש }AvVٌh|xҩdNc4 z Fs#Vu5;ٖ2z?E#$?s;OE8R K 6y N%!Vz{S0rvA=ž5'_yۙ5`E\ rV(}ED1 ރ|s1bo8r݅RJbÁCcH Bۣ3XQUXrS+Xhzǻg)GjE/bͶ_T+vއe>gyogxԍ# BSDԕ,?"|$%3*ڕ?1oul !at 8x!:ȿ:w#v;\zU:pLWCt1~G^,ns8询E0Gz50֖RϢv}Uz d^U#-bOH#,|Yq`!g ?A] \PF`]aYtGIk Џf*΅9fmvcd4P9z]=t5S`4q*W Ǜ#9Vc;X/qHNCdBpًrF4OA'7{H7v7ՐQ~D2x\582 9>=5= ͅ(XxЧՕ&覮qDt2ɍ\#/j\|GxSXbig7sa?"`=S혖cd{l`f+n{O Ct6 ^Z}v6"~q#[ړxtm0  '%j+Ƌ 1݉5)34mzM= xl5JΪ~|fDn}*L-kguЫpArB{ 3wjtO-XZ?wL/M1I)G<-_n{į*5qa;{yQjuV7iju[Vxi>V+ʬփVxc^NjUC8i?'.+R LOmCd ?C zGN39O.2Bk7]nV]{e<%ӝ<+鉣I%j/'h1-_N׺UDW Іhk6F+&D#^x6R 7VS)ƇLcσ|hbZNgE꿃s74e@R B( 8ӡ'cl cJ^czϳ9Zg}̑?zOy,of8~Nukv_A=/hccl 1|yjLby4΂ @flԩO/#WcGп8c&FEa/!.۽]4cC3Yo.bb얭n=-{eyej=G4ճy{`[x^{`/XW.F:l v_,s\zTpLB79/JЬۥ˃g.Msarp|L-|vʫRAٳ(}.T}lJ-7˒D]N'$ZVR\ຸ>|\T6dn7,L|"m nK L`h-s{gvu8<&[7|!x9$Bf(hegR]Zd_j,Lbq趉#ت l\n}9~vQYΊzveB]CK0zrM9+~Ii:hZg/U~9UiH}?>T)Ќl$drx Յքֻ>KhhS>QGo !B~  ]ݘsJXca;Jī{vƺpf8;) #+/\z,< I鐛Ic"mL> !|y\2 C\/VԘJR%GlSxUx;77w&|U2&5\<8n Nτχ/%SᦈE"Vy GG@cu 42*2&R_""U nEfEp}mststjocmXN>HG)_X~tN)cR읕ϔse꼚z^4%6qbhߢ5EKѺ&@}!w ;{}I^];yy"z z(Q/zƴq Lqw7i micM~toȯ@70-_@ H{1؆f-_Wsq3JW?,TmwEՠG2#r 9aEh!&. 완TuǨ5r*׃ȵ (hŐ_tKtg` ^yσ~:qOc@R5~yH~ Uh!sGB{hSmjw RkC( /в c/]Ŵ=6^+!{n?@}'d>}t4f$J}Ac&ABa7I!3t螨}-' whFj*J_ ̃cA z88=*TAm2z4@axBo#׃A)h"QRGԘ~2^,=B{d%1 `eySKa ;C~@^Bރu%M rwSF2e|72 , z3McZ#='2Y\>(KBVEg)[MG#,!ߋb~*].b1`X!Vb,b.>,N3⼸$!}2"2GptEQ,!~cd('itTYx?BEr BicK.dI'h9g_wW]ٞI+2G9x-8?aZv|{=2z=q/z=| wS_D)M༈43!9>SGx !<$xd6 T4l7r1JZw'Y}+7fy;z;{R\x њT/}[HmIxSyZO)pw8Y0l {9[X`CneͼBt6wzgxg4DUS\C@1fǼq,[]]DyꩄN:Yk&+{{ʼ=|/D ɗg2|^6XE%J{;ޮav\ǭ`eSsI龙VՊzo!_*SSb5īh/OOzxHՙ;}T4_h҃hL"esS-sпĿܿho[;G'g[hHc.N j&_ hoȫ*ހc~3.m/m>_:'Jz$Jb! j٠k6vf祏 Ӧ >Y!3;H-=)N7|BGj|~clY nMpguN| K{26L_;֫vUa\mUwX5z2s2'U{Zd8NVv{hHmTOemgLceVO2X߭V#]C`Yk=uf<36*NZq؇s3ӘE?chA r5/ȁs#csF X!ovLjmZaN1Zd8ڬ<kKhmЙKvuC[ ,)AЦSs@˺Y? =k w^ޫ:d8oQgЉBp@τ|% |g 纂9G6"k/8o9wى  {7Ÿ{ժ,t^\OگW:a1O _#3npj#o˃$e-@hԂu9N)ZDl!H:oLXZ;8,QhsE^htENXHx ߵa!'GN;%&;h?!h59M):>Fm$1|ι}R NѢ 6ZU}N$z>t6%ۖ ʛkwUf T:)Z>ДI|N:'N|$1H{>ImhC>;I6o]6~'m74/c`;Z?9&!)f:$)3JWzڔnqxD>/C :kuΉz_ǎwnտRIH@KߙK0ߡȵI2Kc:`eZWu =g@K_tϻǚK-c] Q>IpPIpxL,Jӆ/STV(é[Rnz(KաxXKo?sJ7.ʦP~3AW$_]kr}n~Jz:~&%h5O %+czjz*Jׂln܅sM\ZD4j::ǏIuwwUh/긞`B ;  8Dp9Wg_0&%xKݾuؘSϭtv\oMn9y,Jwk'Oט3ӖI[[8A8 y jb&$auM?wm7-6-U/Y_W S(g, Z#/<,iu#Swu&|eƩt,>~ kQS 18X6j<* %5plX yJkM<Њ hpbӑw*pJ wByH pt?{Q. ʐ:3s%p0p%'d$p^@)x`L<8x80c<T _FH6zz00l֏B[/=v4deA3rУO"yVh"wv0Q(q=ݮ}7ωD|p7EPψ=o`{;w+B&u !,%%#X^OIjv:2 -p(I9l2_kr ||ŧ)p™zbWP9\cxÓ5EVr^IP-k":YQί$U䭣kX*'|ûZM;>mlz[QkY~Öjg#ގ|߃vb"Z2xH|$)ܯ|cGYr›%i2ov{}?.7;4ieϲgQmϡ~Sm/AE^! 7oo $ۍoR Á,ܑ3A$($IׁwtP߶Qpti ݰ y}'W⾇_OrLqqSNA#26|n ^Ld2Y  Azиъ抂PVjLS@&o HO|"Wh-<o4qPD6/E\lh{E8LǗQ:ztMG_+.qI|"O(W'IMW;IiKKKeP adTF`Nw bQ(7ɛPyY|Mv099q̕Te\'?/?/.!o*Zb\"Ѽer(ruZk׊1r\!+J1VuaJjZohXVjTJ=RX~B^6%UR_Oc}[1io+P :A%شQVqVn\h+Hr$\yvo+-Vn|ڶo+hJHJGnBږm+ʹmVnbm+X ǿJRAE}+}&/ܷ>R$ذ3/uگk&o_CSуV4hLHSOs/C|i>D͝yt3x1e H.Uh-eP 5|u+]P R-^oak;DGw.SSĝTzQ>fۭ%)|= 7k %TJm5ylEۦvkQv03,Y=9_ՇxBW3ٮZKZN_7zSߣS9~]r~#ddF'#(0z~F1fVe8cטdL5&ӍcXl,3VR ܳc{NȻqKf56vcg/0SS_}\{˃ q>QKF<O{O'tyxq!n;yJ=/sGEh>w<0rہ@> pY`/m3P%8m (K|'R"~{(?`w6:X`-%bx{w|G? H#0ь}8B8+=-.kFb0@c_;0ox_.͓!'Ļ`GЯ#u&p'ȼz"OTp|<{!? >vj먻2cϠE#{zOHЕ0|/R-܀|~vcfGLs*ٙd{1b1bDDDiJ1b!HCDL)"RDJ)")#)RZ""RT1"B?7^BL Ϟ8g>̞93_"Q(&H(H;0ង'L4iOS*3^Z⩓)'{N9$)΅*4jqU7̯5G,GU߬T =JKIM(eVcFҰ:=I_W[}Atk[eR8p=ѯo1Bh91*,ØpF\)"A$8=capCE rЇ1QŦn\UX|O'ÿ/˹Ϲqۗ ̦:?$UR_?emcL1kFM%q`ixr5ݶBGviTAOM:n|7 DŽ;q\Ӯ&Ġ6kk;2;j22=zSyGz#4M>div*'oޓCon z*@:=҄Cxߊ94g0yMCS&m9Mr*ħ-[NE-ɦZc?7V$f"E{=-wL8NS®? ug{U |羄H^° $ܛP0.aFGz2~rpQ})=/ְ1zD Fh =R ahd.=Yx6 n ,+NqY?*crvd?y]gs"™s炇, ?[&ßԆD7RҼ+a43i+w/7sa̘cLۘ^=:m{=ўBt{=^`/л~^ilӻbew=hL:ғmi%d[!3*{޲IX 9D3!GBY,'mS 9;.\...C[} @N 70T0 8cmbf;s K}>2rl ـ6 jQ6&>)%V`8Ha9zݖr涕ݶjrfnWP n \ no'˩Vvʁ@ [;B0yEo)n"p ȥtC w6ET RtѰ][]뮖- nr9UnX$GeE hj-Rk aA3:6 [h]ZBܔ2ѨaMS˴@ZH'h'ˇ$R-d}"5Ywj(B eQ|@,,cM% K/dV_BZbh 1T~5 e2P˒WHSTZK($@&PpE s,| њ,NK5i-[: "{# PkRRu*J%Iv-æurHY=sK-Y/)m RaoAaGx 2f eֽJOk eZ?|VߢZ,$~]@g1Y~D_9옮f?!/:U`FfFm6MkO`~dC~5(8bi)A @3!` Rs{@ԊI}aV ޴RopJ\dER:=}92U,>KTmgGP7~&r=6FNxlmj65lM &az'}TQ!*Y2>ep: >Pܒ4H7~Z`+崫Q}ӡ";cv#Sw2XR^24+<_ܨ/O}&Iuj -Js")6^(^O(-64́VxT;phjT gXzB})4pTʠlթTDV-M+^y|=FRhq*ڜ{7HP}igMnYԩ@*(m=c{m#7V諡F*Y=JNQRkЪN}=i0EY`zո8W,sm} zRX$ ]MjJO|%iř(mH^v`JJ?,y&.0Qg6.杅B3{MBJ2j1ٻuɌMWݢg$ #FtŽALB<ړ恮w^B>=Y1gjFݚ8DkS\?O^hF4lZ^ 6#3釱W@tI4LDӧw<]]=]}Kw-өշ;{!CٜZgo j1Z0uu=Cp PpzkSme_?5麵3LK(ؓ&QqwF&Dc!RÒةhHE03g⩿n h BV!eZ#0 jOlv*Rp>u8V@zCJ9S) Аr?Z뀙TA;?VswB tw7 uj옻vX[u]Ÿ5w1K2+VY_h6OnXJ눵s oSy:o;N<}x_^^pQom|>Qp ƥ<@J(L /NZ>O3 ?ߪO3|9__X7Bi1s؜6'qVd>OS/[@wOԲEs*H9γ곶8Olu`Ӎ&|Mgm9trÎ3sB%c'_J}V݌,;SϹ$I'\5'Yg>)j㌯=vgGUĉL^\Nv5O^Hu:?K:.-m>?RZo!YeB^U`j$vҭi λ2}3TiU#F󾠧q5fLi+J329*J"{(mS攊2&Mjۚ?*P#DS ^ } -hI$GVB]%WoT/R٭%.K|qϱNzU5cq0|xN*j]z֚ӡQozRVK}OVpj}TɼV[ڛZ'&gmHi1Un+̶v[aθ=ޜi-7A|GB1'k&b`/jo|+w=|?G BtNtDIO#l1X4/F"Q"JWC/ º)41SSFS h)]nib=- +ċNl6C'.=QevCvnc;Rw1<}7{?- \=S/3 uZ)hȰoea'&a > |pk֢f}]-C;C>Ss7ka9}K)W5kO]Zu%RBn^NE/w j-80`}3鱷j"_? uN@`˯حoa 5UXZCݭZ"vZXmm@Βc'H(U k;bA2@{F|ߌXZVClY?Ɩ፿G"dhZV! ={4'NNBT"iP>el;doeSNl+ZNChbVMֻB߭VS^붨{nhzF#ڢѱ*dvftw״f&p˦ħ.x. mT{ӫskV:FtȨ]| /YuO)F:k:ێu"?"[oQ'䞂O%3ٰv!(lJ_k??7)rk-7-WhtZSïI;JԿDcֆ3 /e/5>a\jCD*A\)0Rtah\~߂6EL!~ Z}-y{3>aKa;`_ @'({%/) '"Lsa3}왰/Czg L.g"wU>њn_}ስ {Ha {O4afih2lYz5̊ȥ@5G|M\D4+hڃtJ$4 fa~n9:H}n;\mG\ͧg?*6ig ꬵ7Giiژk9PfZukFo._XsњZvN]Sg[UxrB^4Ǩq{g̈́э2kԧ, cJgQ-f0\?BIϦ\RX?ZSV:wuz?$'!s\̔>~"^[S zhƴ :ڦ㴂]Yۘ9RZPHzmC>=)>V69GHL-pBg-+{;_KhMZ3㿆*| V/q7ײob%#;J?)\]ćLͩT"iRs`5H *(`+ v/} Ի1z@DId~fC#]l<~ 嫵;]Įf7;l͊l"{M,D1+_bnht{E MXiڬrג5/rSvj'!w-߷ =}tM39Ҙ NgqcJ:i׸KOӨܤ0јޘbl<2}άX{cݭG[vl)嶁E#mmS9Әy6ƆnoaLC{gJ'ϔ;L%ܠ>9m,p' F2Ӱ\GaȾ43̝eheZ] ܵ-vkW sωaLJM(].(ͯX bǁwy{y\~qǺ~%ԟ) `7[ t0GR%j?θa河Rw"KqtbV#|weI$]ʮHLd]&eWzkޫޫ,YrvuZ S$t$b,NY^6Vf[9+*Ztk6vXe eHm޲vY{s5ЛށVwx4ގw>|H^y)g9G">OT\?͗T+|=Nqz $Zt^dR#h!Zĥw">7q9"W X1fy)D,EFl`_L|ɫ3VCE;hiv[a9LPY=xfY`%syzy/ nlo ,Pn_ ]6tm7tmazt4tke=CkCCׇ@>CdžO ] ]LU>72};lPyPwPWetLZ.k\rmM+5]r.t .7Q&i\O6tAM+ܐMt5]Y.=[hs4]nK]{>7U瞧jmt7T*[.醺 um u.6t7t]b0t] :.3tu4t]n4t]::4tu5t] ]Waw:MSC=MvauB!G?"称j*bl=L\nvd{Y%M,V +jOtN9fc{'l9 ބMfl{V$GIHz;"Iog$v{=5ǽ`޻|wEO$"ww$"q$|?{ z՘֊-" f,Kܖ:nDIȫew;Ndk@J>)}C{Se,|)ҖġNZӡslhɷ1.7~7J >!zGAI[ɧ;|t4C\FOa*}RJT?ǹVxq %!i#ms 4!gSJ3mH}@b*~8Vͪ'b;zҰqCNHkߌғys j`4u|pZ;[kbhM|⥢#q]1UHL3+~& p1ϊoKO/b(!7ſ;?^d{Z^#eW$ˁ2GCP/w{8y$')r&r%g9r'r|J.O˥r\. r|UMnr*%ߖr/CKY'$9:iniw2NG'\d9ݝkm]?Y~__751PIhB44+4'yTrArQrqrIjm[/W+CaGģ'TGBxj@|H5DdSQjp,EX 15w|CT~^K ttz9Q#$6wq5浉`B yj? ~4YQ/7KU~w_?W/kchtнqC~z,1$?y\?H~za{B\ .TX<&~.O?[#j6_ {WO}mD|*/2[2O#hY(9AN,S^^*_ȵr(6En=r< +aYpqf}99[qs rن:]򝤕煼^K:z޵ލ޷[o7{{=C#>=?[~G?{%O_Ƈf&N.L<>4yR`ڽnR[i_68-5L.mXij{TioǶE:[ jmo}(>4-ޭm̐/?ɿȿdSiZ#L~!:#HkZhmBz{}N??~|??ǿĿ̿¿ҿڿ_/JE_*}?t_觡ǓJ;HaCmm'X*Ki˯?wZ=NT|Ũv=?7c=iP@kbZ IfJ@ikFq8a?RTAC UJIrI$ހJQ쩱;k 5akWꭠUmGK>V䮔qF/l6 A>DAhJgmڔó&E5ܶZ"&)Nq^8+:'m=}}(M/xߟ9-q&!jR[5,$$TUIUQb#-bD{}{WZm~>g{;;s,5ղmmY5jmSf15cPZZOYnc}c+llalŊ8v\Ȋ9ތZܝ:Ue՜8d՝:]f>Κƚ9kOj~?Rx1NXiKJѿh[1S1[k$1YLRJL$%bX!x1U$D1],JZQMP q&y!Ǹu"JUm/*7uv|]e|9_AɁZ>lM{_ػ{O^ܚwᢓ,"[AQtfE(э4"l7K;%hO|KGntmyvL~wv">"ŗ%zq;}-6xa=}=>,BE(EwOOѓ'|&R$"mRڬ߈o:#7-|O3> ]D~ ~1~SG/J#j3V|Gr!Ƭ hA۳@p*]Uɺz/} q"߻+dg9G!{ l-܁;v+qy+/)‹wy1^?Xq|'| S4>s>^!]F| *GcQETj!jZ[>+>gh Fh"|碩h&(-XAcap}>RX=N'Id}Oy\}/Ib}D_/ח+*}Z_&}>MO ~Sf}OoS}CߣO3Y~YY_& 1=Y߮4}_? ~X?Os~I_w 0 P$P[c)YVi|~zA)KpJ,_PT:V4$*c/.aOT*[irLmeOˁK)-"*a>0Yu,Vn^vY?mo]Z|KTo,MO*M޹d`/",~-v e YxQ[ԶɌ/%M"N0ň"2g#)r泌=>+ULQ))kI(SL1q"H(LcŎ2Rx*YhXgWS.5.*h[=^ [[Es `E%9rv x??\Z'&q3턙k3|/JO3'v|hg_m5VߓϒۼQzuwk"D?dTidvݸ}Vej9 9Y1rYtQ(VWWTUf_ڳ+WzJikmn={ǩ#zlm]+} >seȢe~6I^|6K0i/6˕eg>sg^uؤ|v+eG! }YTQGIߐ`;ֽUg om>Ғ{]U6!_> ubGF[x%t9>]EgozWlu?q '`C?6MZ\ll/J_(}b"5[795935+htFm9Ug$?mu v&۹,8˚ #(Lɬ# l$4=$dψlKai;N \ܙr_qƼ9o0;ͣ@G9z,&S(UHT.a}اFtt~*R_ihL%QYW*iJr\9\S(U*ԼjAVPj}F Rj,#3zu굧a< Z[5hAZ] bXm6SKԖk뵭Zk״;C y   *oC}CSCC!0c5H5+|E)ȉȉFM!!Qțț7}(o~a0U=|DMVWkH櫵$ٜ,A #YШUGw[&ٗwp-hmOr6]Kr6RzkMZ ɭNm=6GINjI.k7H^nkHޥӘjP f Ðːd^c)% VC biK҇RחdcCsC $ TO5t4Ma$c I&L06$oXlXIra0ɑd4Q&g۔$GU45QM&9T$G#~dn!mgjL5ɖv .$LQ^${6 4Őbi#khJ oiOr) VczS2F0jx5X+e{t#djr\Ys|r\\42{1 I~Beɺ$}-H1;`3G04!mHryy$XD$皓H&W\i^okdN1ig>D2||Iy7wH6߳0-ŁEXreg)Hn)NŋRBRʿʿŗ"jiN1?E0gCm//ʘKL 0 3 p0 30#3H03 h030cĂ f,`Ƃ&8030ăf*`I&40L3t03 033,03l030s3<03|0,0`$Yf!`$I"0,b0K,R0K, 20,r0+J0+ *0j0kZ0k:0l &0lL2d0`f ` fm`I&v0l &L*]`v& L400{^0{>00sA0I&L 0sO`~`9 #`9 (`9`9`N9 $`N9`N9 3`΀9 ,`΁9`΃9 `$^5CE~1\^zdzx!Kc"Q([=ĴL+0Lk0| 0_i 6`ڂi -v`ځi?0`i=` &L 0A`  `: &LG0t L'0tLg0`B & L8p0` ` &L0`"D& k^Hbc/Щg #<#<-#<#<-#<#<-#<#<-#<#<-z0#f `6 6``xQC$*]\s u0\s 07sM0s /`~#QΞ%GfU`YVy>k̚ gA̶Xu9]'ȶNl&\=:}r59ˇ gza't}: - {2l8DgAl1fCSZ3;j &j'Jte d}B= {bm9ڌbmek .?N-1Ɉ4Ϧ@!' !' !' !' !!!!!O@CCC\C,ChGq^U&62i!k qe<+ C-bjQ[䧞w+bL7㝩oYdɖx_i{ߔ2vXr^ìODɇgy' 9;}z4oll$FS~h1 ͋#,e}mK,G{ŬGv`Veؿsϻ^GVRJL+TJ! kGuJ!^ c{zgr~,%u\ݞ>%Iɬ)α>)&"*2cʞ<֔(wsG}/ )C?m1[%ޫ/ĝxf,q9 Zk{DCdh Wc]s{  ?b96rf/eԺ_XvRi5\)+ne}Tݕl9۵3)sTߤlVҩnkh}ˆ|Jvﳥ>}}>{Oך3ܗ 95?缱y0rI|Io}gs6Q׭Z3>K_ruیG1r3MCT#䏟1gyxBt ߸YfPHd ][+=wNzܵB%r֖OFr?Yfec߻Wl$p- 7I/f.40ทjjk8/h &ttr wKFS9]b%nG~q@E3rӑ2Vז=o.~)TN.`p7pp/pp? 0|H"eDT@G`Y(\TS3ɶ)xɍcLU', ^&^Ge1kX Vut*Ȝԓ y9zU]BOٷWx3۟K_^S!Zw=_ӮI?u<+\h)rsY~tSNN2(2!qIƇ'=;S'7Jb|lSm9le=TyeEX}\* rD!9^  vHg8R[wKQhW*־jn5SK^j%ZS6TUFuNVs$u\d+-P4Y˫jZqC+g0"AuAj1%=0pH,=  {b`~A`:0x0(8$4 , ?D#Q@hndMG#r#p3F!NJooo!uJO~AkW\ l7 W +VˈΥjGv*V/*۟G`9G:&13ktFK>~ӹI.MTsOGh()T%Y%\76¸&j_$g,B *c-dZ.s ޴ےbGkb6Z9ť,)޲bKwvAMV=S[n z@Ms|ŚS084l4xJ%g!##ÃjGt # [ K'}CBK7 ְF5kt =+T޳%姵ߢl,AnwtQ5YZo΁nMjRrխ.IZ$0{H@k4wϚhĈwP9gO|\]XǾmF -73@eO}zQWls|JK^O Nʝ+Iҵ; q՝-žWvû卓 }joXz^WV$\QTU>K6\lΔhqKW\:U*BŽw _gMtTk*}Bǯ;k~gܵ V͔CRfxQ5h lk$=3aȏotO}KTuPOJ%i91_zҮTηrNM 6i>,@-5oEw~Iɤ8Y}ϬZ׎5F.˔i#q>y-ӥSdt>*Lf6\D&Mz.F3KĹVZU=zx#^r(]MZJ+)^ηS#k&N{OS%ҖyuZ3vvZRˌ9ڮuVlvd6c\0xlm9;ƕߛG_\X6!Qsk_>+R: pEwZ i=#}ajv>^7(*ϕ]|?N'] ̾>aПN%;u M/߿ 2{{A9FǩcWsU$WK:ڨ3&6(Rѭ4yhc*2rT:m.eqbɗկGpbYS͑XlqŭlPnMBҍyY==*Z+yzzYS˞Fe~  fӰ}XKݻ=mXvTrY#z=P4_kGj[v_+p;GaSo|U]3 2J]|?Zgaq9vt[䘼=f6wnW .릓Q9áU K_#|tkߘGtns&K7T\ Sη<ݯ Cw$s!;&+&VBikJp~Y\Vdq^y^%搊pHSF+[HM S4Hh3?v;4$%`+k5mJ7jAYȊx&k9z`ם1{ƻִΙwڭ~-Y)ÚW\u{CsHtOVtfNz6*m 6K4lqQ!)گq&W1fy}[%J:= zysob̅c<]ִ]*<8ܽhMav>b˟Uzhitz;rW=+S%`Fv 9A4-{#S}j請$YCt3RluYѸutv /rVU+7wb:}RkG]zS5%ǔj C9~g+mN,# uT;JHK͢Ofprd!A!ݪut֊rֲ^Z? 剟eW~2G|FSN2Q Ҏ_Y{-twL:ߩ>21aW 29&vQnv-  \PԍEWkeO{k <*8Q&I+ >oZ~ía:^K.>_+6^ZkVvP=~c vnKW?/sz_]qҾSYͳ '>vT?eY}у&,i>ݰyc>Rd)*,K 8ib yd_7n7on1?'M{]%N94eyF; Ժ3ԋl~hmh ukWP׋37G+G@|֚YBN,>Li< 2/mWVzȕ0$e3eG}7t5 w=U\_;~!eMk0o C;[2ߩF(+8>3 1,Zel̈PcO&Y"Lbi,m5d Le CRk5dM3y:s^~?|s!H޷~+4V+YG]"wA(6r[`.sғsJ'1aaGR;!n܂|}3nPQ~w.e_2#%¡. Wrc$`t2&͇WO\/P5oX' 3fm_$)rҀH[T̝UNA4bpfnoC|WARfc50 *@!#VmIv\ xJ |U1>Ҳ, AneX՗A ?NkѶµFghn!eFƙwl/̛ay|a L E¢pTKSjGf0zЂHQNgEZ`EN;af,%BW(`QФ۵Kl8^#=v.ZXWAz+^3G0G/GE`sүEG!^ ΧFs ӌp$KZ+ tQwj~h{+o֘޷LCDgeMI1BLk_Kln$,,n})eiQQeB8rHm7<]tYX2H-6"ڝJ' K[Gwg#pY^Ѩj:!e1pשΡ"LY15KQ\rbޘ JOq~cZz<ټG(k΍Lیl[bo If5P1 Q6" $Okި!L˴+x):^S<, 5<.?۾UѪ'slGxZ} c26y6}]c-Y IPt dU6AӺػ-.3 r)+hPRU~5âYP7J%a=f >Ydٯ3evtMf'\ЃD},mXA+gշG skpKBN&鉙OǤ=ZHx}G4A֟uWQ endstream endobj 93 0 obj <>stream x}n0E|"CR !H,Pi?CTeȂ>stream xRn0>8RġHX/SJ-kwgvf¼x)t3vԍVh%=Fs俲L:r9 IH`GبnOAnF;/]\@hDAVj,7øt3k4@Tl$ԭ$;Ϭ}-*ёCSʩG40#:XMC6Q.Gay.ǹ[lE ?VJݵ#lz4 $FMb &Ǔ-8e2@M?ɔ'+ɣE޹>q 'sLi| endstream endobj 95 0 obj <>stream x\ \T?a :,( %0(03lQI_Vji5h&ʴ6J-Sxs }}|w9{@ Aܢ :i|hRqYrp):4(9tǏ Ҏ3r'4 Z9ᮄNl{֙o]\JsU #N!a~sbpVbJp:p7@ UW.0< Sc#,?2ܷaފZ낰75&Ӈg~uku ̜ʏPkV? Pu@S5>^⸚M(_5o7gl{d4y PI;Lo;="Guƈb(I3fY}p8k$ɞ9ÁcyT ӑAއ- RPH7J0i[tRʯ'=##]5)KzJ%oA#~'C 5Ƀ!7J;InYj⟂2 ^ug[?p?rD'RuGrgo 09!*A Έ."v+";p=< }W HA$^!01BxB!Q1 !Q j7HBb 1q/H@L$$HFLfxR 1R M< 鐎P0@`8#fB #a$bd?u0 qF Z'" ِ8 @s!1"q3'D|G'C#)0q*Li q:O z(A,RR3a=,0F#~s t:oʑփ*cJJBj#"E<`b Bx ̈f 97A=b=C X`El q4!6? ůa!Ûf[V[6``1bhFl%WRX #.+`%JX%~ nG8Ոk` ZCVV9w]H݈w#~"3" 7&Mp)܇#lFz3lAz lE ">!xaxc㈏6m <cO"$<4m&~mq'B >nxY؃a/^o<<<>x؏p"KpP!C2" !5x 7M70ax -xm8"0<" {>.|G> A7#cD<1c)|_ ~@|×H _!~逯'oO1÷w=p4A~߄33?1~A/p,߀spҿw "%DN'tADDq?쬔ӠՓOnI2bi-tpuQZtpW$? u8[R&*w5?OrAL A:{:xy8kOrkX$oWAvg;I45}PU_7\ b^a U[+ wp|}Cj~>`/A7U}rͫ|:8_!U}r)R8HI?۳O*w02@ @ܮ }JꝮ! b-l-bg:`~1UL!*_J77a  |}9҈j*_?{H\\C \;H'1p?Ps)?7wW1n)v߿ O 2p[WYUb_H2p=EJ2p?qrTQqoQ?['7l~?se7H 2Di^r ߮hg5w% h?3g&8Sf( sqxѣ9"sxMrRbB|\lLtTd:G]Ds2b ۹lY%SѶh0:k3EJyʃv69ƕђ%>iɢejgb)z|G؈Ei3K2m{+ijRt=i&2rz%aMU6ގʰA6jVqCLۈ}}siQ`I_y.ykBzuu5I/oFȽ MP* Bnho>dF8t`(86/>/Cm_.ۉgVCl_<6<>].2mJY[\-^\NDZD^ D\&,-G{90r6=QĺKNNEmeVme\`=E%'KmKɮڅ4 xn_o[T.mݎUVO[mȵiչB[~lun,+.i[5fu{ŭ3ܪB)cvGG,Xψkiqq-q-@[F3 ZҦ1sĹ( +2b32֠I<\soZMahu:2,_qG 1Ey\z${ܢ R !p*w]i/8y"D=7u.։َԇJW6jSVxk f9}GW QP JXZl4"I5yrҩyqy.n;esJ#Tq3 0`FtkjEmˆ܏A Gk$ђd:C'ϒvy|Kr0.rUrks/(>'JtAr&PrFrV%$NYb8R,׈xBз oՠVf &2xmG,/w(|} _ҷ8T?FI :28OdYK6ncej8+ns7sk&n/w;3!2 ~_o=^~3_pzIAӒW%KI5ґl}2OY,]V$kM.BDVi'I^/s%3w4K!8Yk~F {\דhfRIfA~"֑"~*"z$=:i -|'mjX&7("sY+ \d/bH;L~s_E w-/qǵU=19&uOc[`yIK22{L\~p_tztfs9q'GXuA}1j^#FpsTqČ Ux~FjCdr==JT\\'_:53@u>k3 Fguf;EV%KV Az%S=@\jr3)*vuQHҽVǫwtvtYgffKG MTL.*IdKĤlRə4iR@ŃIIIZ--x/uM;i8 K% MTf)')g+k7+ePR&w]$x+eJp<$H+dR4>JMyQI.r P<}-xztVVVf2M")~-V$̤')@҈yIն}՝Uo\JFɚߟN;C~0>&K>y~d:)<5-1.N P0ohRΙh$v"ߓR8*919*`x湰jfɧϞVu(fѓO>}ZL"*:ʾW60xRؗ0?奥dX$qCIX-3ٓ]߼\x{rx ?'Z}¡' (ݗ{MNJ]5귺>?c3, 1U,qVzw[ d)bۉ[Z\#;PUUꏪ3=hi&D+"#ã"]b"Yv"I7BsD$ S!zGz We1Y&7i=}EE XRA.)aU93+^7BȔͯ|9iic4ԼGg[RC3~]ɭtɃn޵2kUMm}T]:YwsO3o\dӵ\\̟\-ח[ps{u S=AsA9f;hI:R\s68h8h'rJ"RYi\v%RI`H-b1ZV0zO\:́tP:AKzՑi-U(v:h%vPA@+ʯt`˻Vґ$rMdK/]c:^H{mݫ`mkƲܫNh/:_DF̊^8/n2*uzM(6Mu&+STMuF$ꬺ?]S#`17TtQT[nF7[hݔ 3٨7YLBCUC~xh&drqX(^gn2Fc]0҈jd,6ZJSU#uXkFT lj,B15:!A4V5rŨ uzk]S`6 FkAjj zVdjuX`jMPsb}^I0yzbZ:}XFCՈJ yk5k5 J0Q4`%c`bm]}3%j5HNnllLu2 {I$Zk-s$Q [4jk`MzfW4Q@}$Ԁ5 gPt}AgEW-]SS\ot#U6kV+vWĴi}aE@:J:B}Z1כ*:)Mm@c5Vս$kAu CeMu5MB1V0Ԗ,c&-^AgZod~syڼ1Fj+ވVjLMnꘘPaj:Նs_& uMtBCO܈2\lơLPx(gʡ\CpS^V|Ab=T6~P=Xǧ.ƣ2'cO79o3C򍬆lT.rOC,DN 4`ojڄ:#c~SP (m=X^bUЀf\z(`GQ/EMW=;Wcj ^^#TmT2 LL7YeEJtjD .g#bekkM35O̙%՟֡VO`}w.gu >̩Àj֯9yٳZљv>LbZм[:J^$6mxlul{٥6c^/]48z22kY^BufZq]$Ȯ$챯_&9dIfkqdD+1hsHSz`(\Ti |o鬖2[ 9V3/1ߠ_YlhbY4cM{3lfUꐮ=5^#?p*{tH[{cf lC=4MJ g?5:45_T0==mSèO$]._+zְ=Y]7i=&v]l4ڿ] QXd]USx=Zx9~RZYt =O5[??$y[瘙˽w뫽, Ͽ/ptNw8 }8,IB$)|8uX[֡vei1?\@D&bo/^?i~H|_]|7Z9BR5N2iJA)eDB38"RI`Ȣ!'xMA[X50ˏ&Wgmc44͒f~#畆"qKyQWvk\{%ROȼE)^Qx)Yq3m5ե4n)*pZB9J/˻^G֔0M(-/ӃbbUWkdkB\Si25)C^Y]\5δK2y”hM=Rc4ӽznQWT0b4MvzbFJzzJFmhHO} m/nj&;vo'~/Xpӳsw+3^}b ƎkuzۄcVYcnY0W^s'Rr穗n|xCC&NiF/ʞz!sw;f[Xƚ^uNe /|e[ud{t/}5i蛍,TwYAoo}yY6sb0w0 ۧWp2Мs2XZig9a%NyrUYm~۳ >CnfqK}u E"n%E&P\J(›&_ v4\i-VMZq26O@@~!K'BeܯɲvZbDq©Pw2tb]RɃB8E6^IJ;D܆OeTc իjԫ;D *787Qf{7h@Mb->Ȃ+[=*wXb $ً$6NG w&se۞t;xh:MkyELun7" :8_J;w)WU=2#DpˡV\*sճ[&k(:*$|jgF;+;3P{ #);뺬9I]q--tHq2"u9|dODM4 ='e-*ςjٟWYh_b[È~Z!aU/1TK,W]S 儋}2Lq M{ߥ_? Z%_njG B˜9>\TWr5Ӕz4^g1'f#|<,huUj7ASM`4j}@cNCp2IϹcXՌvko4Ձ7fy_V9LE-.k̩ 08^GՈ_zjmz! (6u2lpwʆۦ?UJĥUWXsާV5滤&GT .$&NF0ـT@Jl!R;9O,~]>#bCIts;)U||h* D[uD(@@@^ D\<7$" H"' ߦ1K[mwv3cg-+0 ɉ> :[ɢv{ oIџq-(}\lțEzx6)C95@u|EalREiĪ੒ql( VJ &5+^4\w/Yfz :CHuk_k,EB|~<,%_DAXݖiz 몢O 6KWT .\JKפ\;3Ձ`^>6˽.CM}bSHEAbkLbλ{w(ɣ4([k5?L%q3*QagqxZ5fLԣJȲ/˓>!bl[}iPzH#v^MGy*4Qm6YO+"P wUg)np}:!w\6fQ:#Uh-yϱKNT~!g'&|\mjicÍx1<+J J -0W.jjU5Ws- թWϋ:P Аr0O1bI~D